BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961227 1 start range1961227 1 173 173 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_K831014 1 BBa_K831014 Inducible istR (inhibitor of SOS-induced toxicity by RNA) under the control of lac promoter 2012-09-25T11:00:00Z 2015-05-08T01:13:32Z This part was extracted of the genome of Escherichia coli K12 MG1655 using high fidelity PCR istR is the antitoxin of the TisB/istR chromosomal toxin-antitoxin (TA) module. TisB is a small membrane active antimicrobial peptide is induced during the S.O.S stress response. Also, its induction has been shown to induce persistence (D??rr et al, 2010) false false _1090_ 0 9809 9 It's complicated true None false Silvia J Ca??as component2199432 1 BBa_R0010 component2199440 1 BBa_K831004 annotation2199440 1 BBa_K831004 range2199440 1 209 348 annotation2199432 1 BBa_R0010 range2199432 1 1 200 BBa_K831004 1 BBa_K831004 istR (inhibitor of SOS-induced toxicity by RNA) is small ncRNA of Escherichia coli K12 2012-09-25T11:00:00Z 2015-05-08T01:13:32Z This part was extracted of the genome of Escherichia coli K12 MG1655 using high fidelity PCR istR (inhibitor of SOS-induced toxicity by RNA) is small ncRNA of Escherichia coli K12 that acts as antitoxin for TisB toxin. TisB is a small membrane active antimicrobial peptide induced during the S.O.S stress response. Also, its induction has been shown to induce persistence (D??rr, et al, 2010) false true _1090_ 0 9809 9 It's complicated true None false Silvia J Ca??as annotation2199260 1 istR range2199260 1 1 140 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K831014_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagaggcactaaatacgtcaaaattcgtgccgaaattgcgcgttctgcgcggaacacgtatactttcagtgttgacataatacagtgtgctttgcggttaccagccgcaggcgactgacgaaacctcgctccggcggggtttttt BBa_K831004_sequence 1 gcactaaatacgtcaaaattcgtgccgaaattgcgcgttctgcgcggaacacgtatactttcagtgttgacataatacagtgtgctttgcggttaccagccgcaggcgactgacgaaacctcgctccggcggggtttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z