BBa_K833008 1 BBa_K833008 Mutated prfA-UTR thermosensor from Listeria monocytogenes 2012-10-01T11:00:00Z 2015-05-08T01:13:32Z This part was generated by random mutagenesis of part BBa_K619889 This part was derived from part BBa_K619889 via random mutagenesis and screening for thermosensors that responded to a 35 to 37'C shift. Part BBa_K619889 is a thermosensor for Listeria monocytogenes which normally responds to a 30' to 37'c shift. The thermosensor has a shine delgarno and initiating ATG that are barried within a stem-loop structure at 30'C, but are accessible at higher temperatures as the mRNA structure is disrupted. We monitored thermosensor activity via the reporter LacZ. This thermosensor is part of a library of thermosensors from this screen (see parts (Bba_K833000 to Bba_K833010 and also BBa_K619890,BBa_K61989 -619894 from our 2011 submission). false true _1092_ 0 8978 9 It's complicated false The original part BBa_K619889 from which this part was derived had a mutated shine delgarno to match the preferred sequence for E. coli false Julianne Grose annotation2206448 1 start range2206448 1 102 104 BBa_K833008_sequence 1 tttagcgtgactttccatcaactgctaacaattgttgttactgccaaatgtttttagggtgtttaaaaaaagggcgataaaaaacgataggaggatgagacacgaacgcaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z