BBa_K833014 1 BBa_K833014 constitutive promoter followed by a lox site with a bidirectional terminator and then a lox site. 2012-10-02T11:00:00Z 2015-05-08T01:13:32Z This part was made by overlapping primer extension to knit together a constitutive promoter followed by a lox site, followed by a bidirectional terminator, followed by another lox site This part is a constitutive promoter followed by a lox site with a bidirectional terminator and then a lox site. Can be used to allow transcription of a downstream gene in response to expression of Cre. false false _1092_ 0 8978 9 Not in stock false none false Julianne Grose annotation2209477 1 LOXP site range2209477 1 117 149 annotation2209474 1 constitutive promoter range2209474 1 1 35 annotation2209476 1 bidirectional terminator range2209476 1 70 116 annotation2209475 1 LOXPsite range2209475 1 36 69 BBa_K833014_sequence 1 tttacggctagctcagtcctaggtatagtgctagcataacttcgtatagcatacattatacgaagttatagagaatataaaaagccagattattaatccggcttttttattatttataacttcgtatagcatacattatacgaagttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z