BBa_K836004 1 gpS Lysis inhibitor from Enterobacteria phage lambda (codon usage optimized for R. opacus) 2012-09-19T11:00:00Z 2015-05-08T01:13:32Z The amino sequence was obtained from Uniprot (http://www.uniprot.org/uniprot/P03705#section_seq lysis inhibitor isoform). The codon optimization for R. opacus (avoiding standard restriction sites EcoRI, PstI, XbaI and SpeI) was made using the free software GeneDesigner from DNA 2.0. This protein is the one in charge to avoid the formation of pores in the inner membrane of the bacterial cell. It has been optimized for expression in R. opacus. A weak RBS for Gram positive bacteria was used (http://partsregistry.org/Part:BBa_K090506:Design)in order to obtain low concentration of the protein. false false _1095_ 0 11819 9 Not in stock false We wanted a low concentration of this protein since medium to large concentrations could affect or completely inhibit the lysis device. Basal but constitutive expression of this protein is needed to avoid the formation of pores in the design lysis device. false Ricardo Alvarado annotation2187517 1 Lambda antiholin range2187517 1 18 338 annotation2187515 1 BBa_K090506 range2187515 1 1 11 annotation2187516 1 Scar range2187516 1 12 17 BBa_K836004_sequence 1 agaggtggtgttactagatgaaaatgcctgagaaacatgacctgctcgccgcaatcctggcagccaaggaacagggcattggcgccatcctggccttcgcgatggcgtatctccgcggtcggtacaacggcggagccttcaccaagaccgtcatcgacgcaaccatgtgcgcgatcatcgcatggttcatcagagatctcctggacttcgccggactgtcgtccaatctcgcctacatcacaagtgtgttcatcgggtacatcggcacggactccatcggctcgctgatcaagcggttcgccgccaagaaggcgggggttgaagacggtcgcaaccaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z