BBa_K836006 1 gpS Lysis protein S from Enterobacteria phage lambda (codon usage optimized for R. opacus) 2012-09-19T11:00:00Z 2015-05-08T01:13:32Z The amino sequence was obtained from Uniprot (http://www.uniprot.org/uniprot/P03705#section_seq lysis protein S) and optimized for R. opacus (avoiding standard restriction sites) using the free software GeneDesigner from DNA 2.0. This gene codifies for a protein that makes holes in the inner membrane of the bacterial cell. A Gram positive RBS (SpoVG, http://partsregistry.org/wiki/index.php?title=Part:BBa_K143021) was added at the beginning. false false _1095_ 0 11819 9 Not in stock false Between the RBS and the CDS a spacer consisting on a scar from a standard suffix and a preffix for CDS was inserted. false Ricardo Alvarado annotation2187528 1 Holin range2187528 1 19 333 annotation2187525 1 SpoVG range2187525 1 1 12 annotation2187527 1 Spacer range2187527 1 13 18 BBa_K836006_sequence 1 aaaggtggtgaatactagatgccagaaaagcacgacctactcgcagccatcctcgcggcaaaggagcagggcattggggcgatcctagctttcgcgatggcctacctccggggccgctacaacggcggtgcgttcaccaagacagtcatcgacgccactatgtgcgccatcattgcctggttcatccgagacctcctggacttcgctggactctcgtcgaacctggcgtacatcacctcagtcttcataggatacatcggcaccgactcaatcgggtctctcatcaagcggttcgcggccaagaaggccggtgtcgaggatgggcgcaaccaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z