BBa_K836008 1 nitA promo nitA promoter 2012-09-19T11:00:00Z 2015-05-08T01:13:33Z Promoter taken from NCBI (http://www.ncbi.nlm.nih.gov/nucleotide/346420896?report=genbank&log$=nuclalign&blast_rank=1&RID=W0SH1PA7016). Promoter inducible by nitrile and similar agents. false false _1095_ 0 11819 9 Not in stock false The sequence was used as reported. false Ricardo Alvarado & Veronica Delgado annotation2187537 1 nitA promoter range2187537 1 1 115 BBa_K836008_sequence 1 gcgaactcccttatgcgggtggcgcagaatgccaggacccttgtcattccacgtcaattcatgcgccttttcacctcgtactgtcctgccaaacacaagcaacggaggtacggac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z