BBa_K842001 1 BBa_K842001 flhD 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z Flagellar transcriptional regulator FlhD ??? Escherichia coli (strain K12). (n.d.). UniProt. Retrieved October 1, 2012, from http://www.uniprot.org/uniprot/P0A8S9 flhD along with flhC forms the master regulation operon for the synthesis of flagella in E. coli. They are responsible for the downstream transcription of the class 2 flagella genes. flhD is directly induced by several separate systems, among these is the two-component quorum sensing response system, qseB and qseC. Used for reconstitution of flagella apparatus in E. coli B strains. Cloning and Uses This part was generated via PCR from the E. coli strain DH5α and cloned into the vector pSB1C3. FlhD is to be used in conjunction with flhC in order to form the transcriptional operon for the production of flagella. This part can be used either to generate a flagella in an E. coli strain in which they are not already present, or to promote further formation of pre-existing flagella. false false _1101_ 0 7936 9 It's complicated true none false Sean P. Curran, Percy Genyk, Ellen Park, Rebecca, Gao, Stephan Genyk, Megan Bernstein, Rachel Kohan, Eric Siryj, Luke Quinto annotation2210322 1 flhD range2210322 1 1 360 BBa_K842001_sequence 1 gtgggaataatgcatacctccgagttgctgaaacacatttatgacatcaacttgtcatatttactacttgcacagcgtttgattgttcaggacaaagcgtccgctatgtttcgtctcggcataaatgaagaaatggcgacaacgttagcggcactgactcttccgcaaatggttaagctggcagaaaccaatcaactggtttgtcacttccgttttgacagccaccagacgattactcagttgacgcaagattcccgcgttgacgatctccagcaaattcataccggcatcatgctctcaacacgcttgctgaatgatgttaatcagcctgaagaagcgctgcgcaagaaaagggcctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z