BBa_K842002 1 BBa_K842002 flgJ 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z Nambu, T., Minamino, T., Macnab, R., & Kutsukake, K. (1999). Peptidoglycan-Hydrolyzing Activity of the FlgJ Protein, Essential for Flagellar Rod Formation inSalmonella typhimurium. Journal of Bacteriology, 181(5), 1555-1561. Retrieved October 1, 2012, from http://jb.asm.org/content/181/5/1555 Peptidoglycan hydrolase flgJ ??? Escherichia coli (strain K12). (n.d.). UniProt. Retrieved October 1, 2012, from http://www.uniprot.org/uniprot/P75942 flgJ transcribes a flagellum specific muramidase which hydrolyzes the peptidoglycan layer in the cell membrane. This creates a small hole in the side of the bacterium in which the flagellar rod is formed. It is most commonly believed that flgJ is exported via the flagellum specific exportation system, making it a class 3 flagella gene. Used for reconstitution of flagella apparatus in E. coli B strains. Cloning and Uses This part was generated via PCR from the E. coli strain DH5α and cloned into the vector pSB1C3. It is to be used in conjunction with the entire flagella synthesis genetic pathway to reproduce a complete flagella apparatus. Additionally, if this part is used seperate of the flagellar genetic pathway and connected to a gene promoter, it will continually react with the cell wall until the peptidoglycan layer of the cell membrane can no longer sustain the structure of the bacterium. false false _1101_ 0 7936 9 It's complicated true none false Sean P. Curran, Percy Genyk, Ellen Park, Rebecca, Gao, Stephan Genyk, Megan Bernstein, Rachel Kohan, Eric Siryj, Luke Quinto annotation2210323 1 FlgJ range2210323 1 1 942 BBa_K842002_sequence 1 atgatcagcgacagcaaactactggcaagtgcggcctgggatgcgcaatcactcaacgaactaaaggcgaaagcgggcgaagatccggcggcaaatatccgtccggtggcccgtcaggtggaagggatgttcgtgcagatgatgttgaaaagcatgcgcgacgctttaccaaaagatggcctgttcagcagcgagcacactcgcctgtataccagtatgtatgaccagcagattgcccaacagatgacggcgggcaaaggtctggggcttgcagagatgatggttaaacagatgacgccagaacaaccattgccagaggagtccacgccagcagcaccgatgaaattcccgctcgaaactgtggtgcgttatcaaaatcaggcgctttcgcagctggtgcaaaaggccgtgccacgtaactacgatgattcgctgccgggtgacagtaaagcattcctcgcgcaactctcgctgcccgcccaactggcaagccagcaaagcggtgtgccacatcatttgatcctcgctcaggcggcactggaatctggttgggggcaacggcaaatccgccgcgaaaacggcgagccgagctataacctgtttggtgtcaaagcctctggcaactggaaagggccagttactgaaatcaccacgactgaatatgaaaacggcgaagcgaagaaagtaaaagcgaagtttcgcgtctacagctcgtatctggaagccttgtcggattacgttgggctgttaacgcgtaacccgcgctacgccgccgtgacgaccgccgcgagtgcggaacagggggcgcaggccctacaggacgcgggctatgccaccgatcctcactatgcccgcaaactcaccaacatgattcagcagatgaaatcgataagcgacaaggtgagcaaaacctacagtatgaacattgataatctgttctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z