BBa_K842005 1 BBa_K842005 fliH 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z Minamino, T., & MacNab, R. (n.d.). FliH, a soluble component of the type III flag??? [Mol Microbiol. 2000] ??? PubMed ??? NCBI. National Center for Biotechnology Information. Retrieved October 1, 2012, from http://www.ncbi.nlm.nih.gov/pubmed/10998179 FliH functions as part of the flagella specific export system and is necessary for flageller growth and assembly. It is believed to be part of a two-component system consisting of fliH and fliL that hydrolyses ATP until construction of the flagella apparatus is completed. Used for reconstitution of flagella apparatus in E. coli B strains. Cloning and Uses This part was generated via PCR from the E. coli strain DH5α and cloned into the vector pSB1C3. It is to be used in conjunction with the entire flagella synthesis genetic pathway to reproduce a complete flagella apparatus. false false _1101_ 0 7936 9 It's complicated true none false Sean P. Curran, Percy Genyk, Ellen Park, Rebecca, Gao, Stephan Genyk, Megan Bernstein, Rachel Kohan, Eric Siryj, Luke Quinto annotation2210329 1 fliH range2210329 1 1 687 BBa_K842005_sequence 1 atgtctgataatctgccgtggaaaacctggacgccggacgatctcgcgccaccacaggcagagtttgtgcccatagtcgagccggaagaaaccatcattgaagaggctgaacccagccttgagcagcaactggcgcaactgcaaatgcaggcccatgagcaaggttatcaggcgggtattgccgaaggtcgccagcaaggtcataagcagggctatcaggaaggactggcccaggggctggagcaaggtctggcagaggcgaagtctcaacaagcgccaattcatgcccggatgcagcaactggtcagcgaatttcaaactacccttgatgcacttgatagtgtgatagcgtcgcgcctgatgcagatggcgctggaggcggcacgtcaggtcatcggtcagacgccaacggtggataactcggcactgatcaaacagatccaacagttgttgcagcaagaaccgttattcagcggtaaaccacagctgcgcgtgcacccggatgatctgcaacgtgtggatgatatgctcggcgctaccttaagtttgcatggctggcgcttgcggggcgatcccaccctccatcctggcggctgtaaagtctccgccgatgaaggcgatctcgacgccagtgtcgccactcgctggcaagaactctgccgtctggcagcaccaggagtggtgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z