BBa_K842010 1 BBa_K842010 cheZ 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z Protein phosphatase CheZ ??? Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720). (n.d.). UniProt. Retrieved October 1, 2012, from http://www.uniprot.org/uniprot/P07800 CheZ is a regulatory protein that constantly dephosphorylates cheY that is attached to a flagellum. The incessant dephosphorylation is what causes bacteria to run, stop, and tumble when in an environment that has a concentration gradient and remain responsive to any changes in chemical concentration. Used for researcher control of signaling mechanisms that influence flagella function. Cloning and Uses This part was generated via PCR from the E. coli strain DH5α and cloned into the vector pSB1C3. It is to be used with other chemotaxis genes to form a complete regulatory pathway that controls the response system in MCP and the direction of rotation in flagella. false false _1101_ 0 7936 9 It's complicated true none false Sean P. Curran, Percy Genyk, Ellen Park, Rebecca, Gao, Stephan Genyk, Megan Bernstein, Rachel Kohan, Eric Siryj, Luke Quinto annotation2210334 1 cheZ range2210334 1 1 645 BBa_K842010_sequence 1 atgatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctggcagatgtacccgcgcataccagctttactaacgcgcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z