BBa_K842012 1 BBa_K842012 motB 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z Motility protein B ??? Escherichia coli (strain K12). (n.d.). UniProt. Retrieved October 1, 2012, from http://www.uniprot.org/uniprot/P0AF06 Released HQ 2013 motB is a structural protein for the stationary element of the flagella motor. The protein works in conjunction with motA to form this structure, which then in turn controls the flagella???s rotation. It is also believed that motB is responsible for forming the structure that connects the flagella motor to the cell wall. Used for reconstitution of flagella apparatus in E. coli B strains. Cloning and Uses This part was generated via PCR from the E. coli strain DH5α and cloned into the vector pSB1C3. The protein works in conjunction with motA to form the stationary base of the flagella motor, which then in turn controls the flagella???s rotation. This part can be used in the complete recreation of an E. coli???s genetic flageller pathway. false false _1101_ 0 7936 9 In stock true none false Sean P. Curran, Percy Genyk, Ellen Park, Rebecca, Gao, Stephan Genyk, Megan Bernstein, Rachel Kohan, Eric Siryj, Luke Quinto annotation2210336 1 motB range2210336 1 1 927 BBa_K842012_sequence 1 atgaagaatcaagcgcatccgattattgtcgtcaaacgacgcaaagccaaaagccacggggcagcacatggatcgtggaagattgcttatgccgactttatgactgcgatgatggccttttttctggtgatgtggctgatctccatctccagcccaaaagagctgattcagattgcggagtacttccggactccactggcgactgcggttacgggcggcgatcgcatttctaatagtgaaagcccaattcccggcggtggtgatgattacacccaaagccagggggaagtgaataagcagccgaacatcgaagagctgaaaaaacgcatggagcaaagtcgattgcggaaattgcggggtgatctcgaccagttgatagagtccgatccgaaactgcgggcgttacgtccccatctcaaaatcgatctggtccaggaaggtctacgtattcagatcatcgatagccagaatcgcccgatgtttagaaccggcagtgccgatgtcgaaccctatatgcgcgacattctgcgcgccattgcgcctgtactgaacggtattcccaaccgtattagcctttcaggtcataccgatgatttcccctacgccagcggtgagaaaggatatagcaactgggagctttctgccgatcgggccaatgcatcccgccgcgaactgatggtcggagggttggatagcggcaaagtgttacgtgtcgtcggcatggcggcaacgatgcgcttaagcgatcgcggacctgatgatgccgtcaaccgtcgcatcagcctgctggtactgaacaaacaagccgaacaggccattttgcatgaaaacgccgaaagccagaatgagccagtaagcgccctggaaaaacctgaggttgcaccacaggtcagtgttcccacaatgccatcagccgaaccgaggtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z