BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K843008 1 BBa_K843008 T4 Lysis Device under control of IPTG 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z All parts used for this device is present in parts registry. By using this composite part, it is possible to keep living of bacteria under control of IPTG. This part contains a Kill Switch lysis machine designed by iGEM08 UC Berkeley team, with a cI regulated promoter. Also, there is a cI coding region with a LacI regulated promoter. By this way, in a medium containing IPTG, LacI will be inhibited by IPTG. Therefore, LacI regulated promoter will be active and cI protein will be produced. As a result, cI protein will inhibit cI regulated promoter activity. So, kill switch part (T4 Lysis Device) will not work. In contrast, in the absence of IPTG, LacI inhibits its promoter, and so cI will not be produced. Therefore, cI regulated promoter will be active and T4 Lysis Device take bacteria to the lysis. As a result, this composite part has a big potential to be used as a safety device. false false _1103_ 0 12727 9 It's complicated false Since our project has a potential to be used as a biofilter, safety is a big issue. To create a very safe part, we thought that bacteria should be alive only in our system. If any escape from system occurs, bacteria should kill themselves. Thus, we thought to make their lives depending on an easy-found medium compound, IPTG. false Ali&#351;an Kayab??len component2298712 1 BBa_J23116 component2298714 1 BBa_B0010 component2298701 1 BBa_B0034 component2298716 1 BBa_R0010 component2298708 1 BBa_B0012 component2298705 1 BBa_K112806 component2298728 1 BBa_C0051 component2298696 1 BBa_R0051 component2298706 1 BBa_B0010 component2298703 1 BBa_K112805 component2298724 1 BBa_B0034 component2298713 1 BBa_K112907 annotation2298701 1 BBa_B0034 range2298701 1 58 69 annotation2298705 1 BBa_K112806 range2298705 1 762 1275 annotation2298728 1 BBa_C0051 range2298728 1 1827 2601 annotation2298714 1 BBa_B0010 range2298714 1 1513 1592 annotation2298724 1 BBa_B0034 range2298724 1 1809 1820 annotation2298716 1 BBa_R0010 range2298716 1 1601 1800 annotation2298703 1 BBa_K112805 range2298703 1 78 753 annotation2298708 1 BBa_B0012 range2298708 1 1372 1412 annotation2298712 1 BBa_J23116 range2298712 1 1421 1455 annotation2298696 1 BBa_R0051 range2298696 1 1 49 annotation2298706 1 BBa_B0010 range2298706 1 1284 1363 annotation2298713 1 BBa_K112907 range2298713 1 1464 1504 BBa_K112806 1 BBa_K112806 [T4 endolysin] 2008-10-31T12:00:00Z 2015-05-08T01:09:19Z Enterobacteria phage T4 http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=29366675&from=66503&to=66997&view=gbwithparts Released HQ 2013 The lysozyme from enterobacteria phage T4 degrades peptidoglycan layer. false true _224_ 0 3025 171 In stock false High expression of lysozyme only is toxic to bacteria. false Jin Huh annotation1999018 1 T4 Endolysin range1999018 1 17 511 BBa_K112805 1 BBa_K112805 [T4 holin] 2008-10-30T12:00:00Z 2015-05-08T01:09:19Z Enterobacteria phage T4 http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=29366675&from=160221&to=160877&view=gbwithparts Holins from T4 bacteriophage assemble together to form pores on inner membrane of bacteria allowing lysozyme to reach periplasm and degrade peptidoglycan layer. false true _224_ 0 3025 171 It's complicated false Making composite part of rbs.holin is problematic unless antiholin is expressed in bacteria together. Antiholin binds holin and inhibits the formation of holin. false Jin Huh annotation1999005 1 T4 holin range1999005 1 17 673 BBa_C0051 1 cI lam cI repressor from E. coli phage lambda (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). Released HQ 2013 Coding region for the cI repressor based on cI repressor from bacteriophage lambda modified with an LVA tail for rapid degradation of the protein. cI repressor binds to the cI regulator (BBa_R0051).</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P> References (unparsed) here: <p><a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000</P> <P><a href="http://www.genesdev.org/cgi/content/full/15/22/3013">Octamerization of CI repressor is needed for effective repression of PRM and efficient switching from lysogeny. </a>Ian B. Dodd,1 Alison J. Perkins, Daniel Tsemitsidis, and J. Barry Egan , Genes and Development (Vol 15, No. 22) 3013-3022: 2001</P> <p></p> <P>BBa_C0051 cI repressor is based on the cI repressor from the Elowitz's repressilator. It has been modified to include a rapid degradation LAA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA.<P> true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation23334 1 cI lambda range23334 1 4 711 annotation23335 1 LVA range23335 1 712 744 annotation2213991 1 Help:Barcodes range2213991 1 751 775 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation2024 1 OR1 range2024 1 25 41 annotation2023 1 -35 range2023 1 15 20 annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2025 1 OR2 range2025 1 1 17 annotation2022 1 -10 range2022 1 38 43 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961227 1 start range1961227 1 173 173 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961224 1 -35 range1961224 1 137 142 BBa_J23116 1 BBa_J23116 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_K112907 1 BBa_K112907 Pcon 2008-10-23T11:00:00Z 2015-05-08T01:09:20Z A constituitive promoter false false _224_ 0 2998 9 Not in stock false false Bing Xia BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K112907_sequence 1 gatctttgacagctagctcagtcctaggtataatgctagcg BBa_J23116_sequence 1 ttgacagctagctcagtcctagggactatgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K112805_sequence 1 cttaaaaggagggtctatggcagcacctagaatatcattttcgccctctgatattctatttggtgttctcgatcgcttgttcaaagataacgctaccgggaaggttcttgcttcccgggtagctgtcgtaattcttttgtttataatggcgattgtttggtataggggagatagtttctttgagtactataagcaatcaaagtatgaaacatacagtgaaattattgaaaaggaaagaactgcacgctttgaatctgtcgccctggaacaactccagatagttcatatatcatctgaggcagactttagtgcggtgtattctttccgccctaaaaacttaaactattttgttgatattatagcatacgaaggaaaattaccttcaacaataagtgaaaaatcacttggaggatatcctgttgataaaactatggatgaatatacagttcatttaaatggacgtcattattattccaactcaaaatttgcttttttaccaactaaaaagcctactcccgaaataaactacatgtacagttgtccatattttaatttggataatatctatgctggaacgataaccatgtactggtatagaaatgatcatataagtaatgaccgccttgaatcaatatgtgctcaggcggccagaatattaggaagggctaaataatta BBa_K843008_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagaaagaggagaaatactagagcttaaaaggagggtctatggcagcacctagaatatcattttcgccctctgatattctatttggtgttctcgatcgcttgttcaaagataacgctaccgggaaggttcttgcttcccgggtagctgtcgtaattcttttgtttataatggcgattgtttggtataggggagatagtttctttgagtactataagcaatcaaagtatgaaacatacagtgaaattattgaaaaggaaagaactgcacgctttgaatctgtcgccctggaacaactccagatagttcatatatcatctgaggcagactttagtgcggtgtattctttccgccctaaaaacttaaactattttgttgatattatagcatacgaaggaaaattaccttcaacaataagtgaaaaatcacttggaggatatcctgttgataaaactatggatgaatatacagttcatttaaatggacgtcattattattccaactcaaaatttgcttttttaccaactaaaaagcctactcccgaaataaactacatgtacagttgtccatattttaatttggataatatctatgctggaacgataaccatgtactggtatagaaatgatcatataagtaatgaccgccttgaatcaatatgtgctcaggcggccagaatattaggaagggctaaataattatactagagatacttaggaggtattatgaatatatttgaaatgttacgtatagatgaaggtcttagacttaaaatctataaagacacagaaggctattacactattggcatcggtcatttgcttacaaaaagtccatcacttaatgctgctaaatctgaattagataaagctattgggcgtaattgcaatggtgtaattacaaaagatgaggctgaaaaactctttaatcaggatgttgatgctgctgttcgcggaatcctgagaaatgctaaattaaaaccggtttatgattctcttgatgcggttcgtcgctgtgcattgattaatatggttttccaaatgggagaaaccggtgtggcaggatttactaactctttacgtatgcttcaacaaaaacgctgggatgaagcagcagttaacttagctaaaagtagatggtataatcaaacacctaatcgcgcaaaacgagtcattacaacgtttagaactggcacttgggacgcgtataaaaatctataaagctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttgacagctagctcagtcctagggactatgctagctactagaggatctttgacagctagctcagtcctaggtataatgctagcgtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagcaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_C0051_sequence 1 atgagcacaaaaaagaaaccattaacacaagagcagcttgaggacgcacgtcgccttaaagcaatttatgaaaaaaagaaaaatgaacttggcttatcccaggaatctgtcgcagacaagatggggatggggcagtcaggcgttggtgctttatttaatggcatcaatgcattaaatgcttataacgccgcattgcttgcaaaaattctcaaagttagcgttgaagaatttagcccttcaatcgccagagaaatctacgagatgtatgaagcggttagtatgcagccgtcacttagaagtgagtatgagtaccctgttttttctcatgttcaggcagggatgttctcacctgagcttagaacctttaccaaaggtgatgcggagagatgggtaagcacaaccaaaaaagccagtgattctgcattctggcttgaggttgaaggtaattccatgaccgcaccaacaggctccaagccaagctttcctgacggaatgttaattctcgttgaccctgagcaggctgttgagccaggtgatttctgcatagccagacttgggggtgatgagtttaccttcaagaaactgatcagggatagcggtcaggtgtttttacaaccactaaacccacagtacccaatgatcccatgcaatgagagttgttccgttgtggggaaagttatcgctagtcagtggcctgaagagacgtttggcgctgcaaacgacgaaaactacgctttagtagcttaataacgctgatagtgctagtgtagatcgc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_K112806_sequence 1 atacttaggaggtattatgaatatatttgaaatgttacgtatagatgaaggtcttagacttaaaatctataaagacacagaaggctattacactattggcatcggtcatttgcttacaaaaagtccatcacttaatgctgctaaatctgaattagataaagctattgggcgtaattgcaatggtgtaattacaaaagatgaggctgaaaaactctttaatcaggatgttgatgctgctgttcgcggaatcctgagaaatgctaaattaaaaccggtttatgattctcttgatgcggttcgtcgctgtgcattgattaatatggttttccaaatgggagaaaccggtgtggcaggatttactaactctttacgtatgcttcaacaaaaacgctgggatgaagcagcagttaacttagctaaaagtagatggtataatcaaacacctaatcgcgcaaaacgagtcattacaacgtttagaactggcacttgggacgcgtataaaaatctataaagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z