BBa_K844001 1 BBa_K844001 Spider Silk 1x 1E Subunit "U" (native sequence) 2012-10-01T11:00:00Z 2016-02-10T11:26:45Z Based on native 1E sequence from Brooks, et al. (2008) and DNA was artificially synthesized Spider silk subunit (1x) native sequence; contains one elasticity domain and one strength domain. false false _1104_ 4206 13965 9 It's complicated false none false Ryan Putman annotation2212123 1 Beta-spiral range2212123 1 10 24 annotation2212125 1 Beta-spiral range2212125 1 46 60 annotation2212126 1 Beta-Spiral range2212126 1 69 84 annotation2212127 1 Linker Domain range2212127 1 85 102 annotation2212128 1 Strength Domain range2212128 1 103 120 annotation2212122 1 Elasticity Domain range2212122 1 1 84 annotation2212124 1 Beta-spiral range2212124 1 31 45 annotation2212121 1 Beta-helix range2212121 1 1 9 BBa_K844001_sequence 1 ggcggttatggtccgggcgccggccagcaaggtccgggcagccagggtccgggcagcggtggccaacagggtccgggtggtcaggggccgtatggtccgagcgctgcggcagcggctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z