BBa_K844008 1 BBa_K844008 Spider Silk 1x Subunit "B" (Balanced tRNA codon optimized) with Met (ATG) added 2012-10-01T11:00:00Z 2016-02-10T11:28:32Z Created using mutagenesis PCR to add upstream Met (ATG) to part BBa_K844004 Released HQ 2013 Spider silk subunit optimized to use a reduced set of tRNA codons (1 or 2 codons per amino acid); contains two elasticity domains and one strength domain, also contains 5??? Met (ATG) codon. false false _1104_ 4206 13876 9 In stock false none false Andrea Halling annotation2212465 1 Strength Domain range2212465 1 189 207 annotation2212454 1 Beta-spiral range2212454 1 13 27 annotation2212460 1 Beta-spiral range2212460 1 98 113 annotation2212453 1 Elasticity Domain range2212453 1 4 87 annotation2212458 1 Beta-helix range2212458 1 88 97 annotation2212464 1 Linker Domain range2212464 1 172 188 annotation2212455 1 Beta-spiral range2212455 1 34 48 annotation2212459 1 Elasticity Domain range2212459 1 88 171 annotation2212457 1 Beta-spiral range2212457 1 72 87 annotation2212463 1 Beta-spiral range2212463 1 156 171 annotation2212461 1 Beta-sprial range2212461 1 117 132 annotation2212456 1 Beta-spiral range2212456 1 49 63 annotation2212451 1 Start range2212451 1 1 3 annotation2212462 1 Beta-spiral range2212462 1 133 147 annotation2212452 1 Beta-helix range2212452 1 4 12 BBa_K844008_sequence 1 atgggtggatatggtcctggagcaggtcaacaaggaccaggtagtcaaggacctggttctggaggtcaacaaggaccaggtggacaaggtggatatggtcctggagcaggtcaacaaggaccaggtagtcaaggacctggttctggaggtcaacaaggaccaggtggacaaggtccttatggaccaagtgcagcagcagcagcagca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z