BBa_K844010 1 BBa_K844010 Enhanced tRNA Promoter for ''E. coli'' 2012-10-02T11:00:00Z 2015-05-08T01:13:33Z Based on the ZH14 sequence from Bauer et al. (1993), which is a mutated version of leuV tRNA promoter from ''E. coli''. This part is a mutated version of the ''E. coli'' leuV tRNA promoter. This part is based on the ZH14 sequence from Bauer et al. (1993). This promoter has approximately normal growth-rate dependent regulation but 12.0x normal promoter strength in rich medium. It is important to use a tRNA promoter to express tRNA parts, as other promoters will recruit RNA polymerase II, which only synthesizes mRNA. The tRNA promoter will recruit RNA polymerase III, which is the correct polymerase for synthesizing tRNAs. false false _1104_ 0 9404 9 Not in stock false none false Kathleen Miller annotation2210958 1 tRNA promoter for E. coli range2210958 1 1 40 BBa_K844010_sequence 1 cgtattgacgtaaggcgtaaaagtggtagaatgcgcctcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z