BBa_K844012 1 BBa_K844012 tRNA expression cassette for spider silk "F" proteins 2012-10-02T11:00:00Z 2015-05-08T01:13:33Z This part was chemically synthesized but based upon ''E. coli'' genomic DNA sequences, and BioBrick parts BBa_K844010 and BBa_K844011. Description goes here false false _1104_ 0 13876 9 Not in stock false When working with tRNA expression systems, you cannot have scar sites between the promoter and the gene, or between the gene and the terminator. As such, the entire sequence was synthesized without scars. At minimum, no scars can be internal to an individual tRNA expression unit, but can exist between different complete expression units. false Andrea Halling annotation2211027 1 SerGCT (AGT codon) tRNA gene from E. coli range2211027 1 566 658 annotation2211009 1 BBa_K844011 range2211009 1 380 394 annotation2210993 1 BBa_K844010 range2210993 1 133 172 annotation2210990 1 BBa_K844010 range2210990 1 1 40 annotation2211028 1 BBa_K844011 range2211028 1 659 673 annotation2211007 1 BBa_K844011 range2211007 1 248 262 annotation2211044 1 TyrGTA (TAT codon) tRNA gene from E. coli range2211044 1 714 798 annotation2211042 1 BBa_K844010 range2211042 1 674 713 annotation2210991 1 GlyGCC (GGT codon) tRNA gene from E. coli range2210991 1 41 116 annotation2211008 1 BBa_K844010 range2211008 1 263 302 annotation2211013 1 AlaTGC (GCA codon) tRNA gene from E. coli range2211013 1 435 510 annotation2211014 1 BBa_K844011 range2211014 1 511 550 annotation2211011 1 ProGGG (CCT codon) tRNA gene from E. coli range2211011 1 303 379 annotation2211012 1 BBa_K844010 range2211012 1 551 565 annotation2211010 1 BBa_K844010 range2211010 1 395 434 annotation2211006 1 GlnTTG (CAA codon) tRNA gene from E. coli range2211006 1 173 247 annotation2211045 1 BBa_K844011 range2211045 1 799 812 annotation2210992 1 BBa_K844011 range2210992 1 117 132 BBa_K844012_sequence 1 cgtattgacgtaaggcgtaaaagtggtagaatgcgcctccgcgggaatagctcagttggtagagcacgaccttgccaaggtcggggtcgcgagttcgagtctcgtttcccgctccaaatttccaaccctcgcgtattgacgtaaggcgtaaaagtggtagaatgcgcctcctggggtatcgccaagcggtaaggcaccggtttttgataccggcattccctggttcgaatccaggtaccccagccaaatttccaaccctcgcgtattgacgtaaggcgtaaaagtggtagaatgcgcctcccggcacgtagcgcagcctggtagcgcaccgtcatggggtgtcgggggtcggaggttcaaatcctctcgtgccgaccaaatttccaaccctcgcgtattgacgtaaggcgtaaaagtggtagaatgcgcctccggggctatagctcagctgggagagcgcctgctttgcacgcaggaggtctgcggttcgatcccgcatagctccaccaaatttccaaccctcgcgtattgacgtaaggcgtaaaagtggtagaatgcgcctccggtgaggtggccgagaggctgaaggcgctcccctgctaagggagtatgcggtcaaaagctgcatccggggttcgaatccccgcctcaccgccaaatttccaaccctcgcgtattgacgtaaggcgtaaaagtggtagaatgcgcctccggtggggttcccgagcggccaaagggagcagactgtaaatctgccgtcacagacttcgaaggttcgaatccttcccccaccaccaaatttccaaccctcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z