BBa_K844013 1 BBa_K844013 tRNA expression cassette for spider silk "B" proteins 2012-10-02T11:00:00Z 2015-05-08T01:13:33Z This part was chemically synthesized but based upon E. coli genomic DNA sequences, and BioBrick parts BBa_K844010 and BBa_K844011. Description goes here false false _1104_ 0 13965 9 Not in stock false When working with tRNA expression systems, you cannot have scar sites between the promoter and the gene, or between the gene and the terminator. As such, the entire sequence was synthesized without scars. At minimum, no scars can be internal to an individual tRNA expression unit, but can exist between different complete expression units. false Ryan Putman annotation2211092 1 BBa_K844011 range2211092 1 391 405 annotation2211095 1 BBa_K844011 range2211095 1 522 536 annotation2211063 1 BBa_K844011 range2211063 1 116 130 annotation2211098 1 ArgTCT (AGA codon) tRNA from E. coli range2211098 1 577 653 annotation2211093 1 BBa_K844010 range2211093 1 406 445 annotation2211096 1 BBa_K84401 range2211096 1 537 576 annotation2211064 1 ProTGG (CCA codon) tRNA from E. coli range2211064 1 171 247 annotation2211060 1 BBa_K844010 range2211060 1 1 40 annotation2211100 1 BBa_K844011 range2211100 1 654 668 annotation2211091 1 SerGGA (TCT codon) tRNA from E. coli range2211091 1 303 390 annotation2211094 1 ThrGGT (ACT codon) tRNA from E. coli range2211094 1 446 521 annotation2211077 1 BBa_K844011 range2211077 1 248 262 annotation2211090 1 BBa_K844010 range2211090 1 263 302 annotation2211061 1 GlyTCC (GGA codon) tRNA from E. coli range2211061 1 41 115 annotation2211062 1 BBa_K844010 range2211062 1 131 170 BBa_K844013_sequence 1 cgtattgacgtaaggcgtaaaagtggtagaatgcgcctccgcgggcatcgtataatggctattacctcagccttccaagctgatgatgcgggttcgattcccgctgcccgctccaaatttccaaccctcgcgtattgacgtaaggcgtaaaagtggtagaatgcgcctcccggcgagtagcgcagcttggtagcgcaactggtttgggaccagtgggtcggaggttcgaatcctctctcgccgaccaaatttccaaccctcgcgtattgacgtaaggcgtaaaagtggtagaatgcgcctccggtgaggtgtccgagtggctgaaggagcacgcctggaaagtgtgtatacggcaacgtatcgggggttcgaatccccccctcaccgccaaatttccaaccctcgcgtattgacgtaaggcgtaaaagtggtagaatgcgcctccgctgatatggctcagttggtagagcgcacccttggtaagggtgaggtccccagttcgactctgggtatcagcaccaaatttccaaccctcgcgtattgacgtaaggcgtaaaagtggtagaatgcgcctccgcgttgttagctcagccggacagagcaattgccttctgagcaatcggtcactggttcgaatccagtacaacgcgccaaatttccaaccctcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z