BBa_K844004 1 BBa_K844004 Spider Silk 1x Subunit "B" (Balanced tRNA codon optimized) 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z Artificially designed based on BBa_K844002 and DNA was synthesized Spider silk subunit optimized to use a more balanced, but still greatly reduced, number of tRNA codons; contains two elasticity domains and one strength domain. false false _1104_ 0 13876 9 In stock false none false Andrea Halling annotation2212321 1 Beta-spiral range2212321 1 10 24 annotation2212322 1 Beta-spiral range2212322 1 31 45 annotation2212319 1 Elasticity Domain range2212319 1 1 84 annotation2212324 1 Beta-spiral range2212324 1 69 84 annotation2212330 1 Beta-spiral range2212330 1 153 168 annotation2212323 1 Beta-spiral range2212323 1 46 60 annotation2212332 1 Strength Domain range2212332 1 186 204 annotation2212327 1 Beta-spiral range2212327 1 95 110 annotation2212325 1 Elasticity Domain range2212325 1 85 168 annotation2212326 1 Beta-helix range2212326 1 85 94 annotation2212328 1 Beta-spiral range2212328 1 114 129 annotation2212329 1 Beta-spiral range2212329 1 130 144 annotation2212320 1 Beta-helix range2212320 1 1 9 annotation2212331 1 Linker Domain range2212331 1 169 185 BBa_K844000 1 BBa_K844000 10x-Histidine (10x-His) Tag with double stop codon (TAATAA) 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z Constructed through oligonucleotide annealing Released HQ 2013 10x-Histidine tag with double stop codon TAATAA to allow for better extraction of tagged products and protein termination in a single part. false false _1104_ 0 9404 9 In stock true none false Kathleen Miller annotation2206607 1 10x-Histidine Tag range2206607 1 1 30 annotation2206608 1 Stop range2206608 1 31 33 annotation2206609 1 Stop range2206609 1 34 36 BBa_K844016 1 PatgB4HT Spider Silk Generator - 4x "B" Silk Construct with His Tag 2012-10-01T11:00:00Z 2016-02-10T11:27:13Z Silver Fusion assembly of basic parts Protein generator part for Spider Silk. Protein is a 4x fusion of spider silk "B" subunits, which were codon optimized to use a reduced set of tRNA codons (1 to 2 codons per amino acid). Contains a lactose/IPTG inducible , RBS, and a 10x-His tag for purification of protein. IMPORTANT NOTE: This part uses Assembly Standard #23 (Silver Fusion) scar sites, which the sequence data below will not reflect (it shows Assembly Standard #10 scars). false false _1104_ 4206 14072 9 It's complicated true none. false Brian Smith component2211620 1 BBa_K844004 component2211582 1 BBa_K844008 component2211601 1 BBa_K844004 component2211639 1 BBa_K844004 component2211643 1 BBa_K844000 component2211562 1 BBa_K208010 annotation2211562 1 BBa_K208010 range2211562 1 1 220 annotation2211639 1 BBa_K844004 range2211639 1 866 1069 annotation2211601 1 BBa_K844004 range2211601 1 442 645 annotation2211582 1 BBa_K844008 range2211582 1 227 433 annotation2211620 1 BBa_K844004 range2211620 1 654 857 annotation2211643 1 BBa_K844000 range2211643 1 1078 1113 BBa_K844008 1 BBa_K844008 Spider Silk 1x Subunit "B" (Balanced tRNA codon optimized) with Met (ATG) added 2012-10-01T11:00:00Z 2016-02-10T11:28:32Z Created using mutagenesis PCR to add upstream Met (ATG) to part BBa_K844004 Released HQ 2013 Spider silk subunit optimized to use a reduced set of tRNA codons (1 or 2 codons per amino acid); contains two elasticity domains and one strength domain, also contains 5??? Met (ATG) codon. false false _1104_ 4206 13876 9 In stock false none false Andrea Halling annotation2212458 1 Beta-helix range2212458 1 88 97 annotation2212463 1 Beta-spiral range2212463 1 156 171 annotation2212459 1 Elasticity Domain range2212459 1 88 171 annotation2212454 1 Beta-spiral range2212454 1 13 27 annotation2212461 1 Beta-sprial range2212461 1 117 132 annotation2212460 1 Beta-spiral range2212460 1 98 113 annotation2212464 1 Linker Domain range2212464 1 172 188 annotation2212457 1 Beta-spiral range2212457 1 72 87 annotation2212465 1 Strength Domain range2212465 1 189 207 annotation2212455 1 Beta-spiral range2212455 1 34 48 annotation2212456 1 Beta-spiral range2212456 1 49 63 annotation2212451 1 Start range2212451 1 1 3 annotation2212462 1 Beta-spiral range2212462 1 133 147 annotation2212452 1 Beta-helix range2212452 1 4 12 annotation2212453 1 Elasticity Domain range2212453 1 4 87 BBa_K208010 1 BBa_K208010 Lac Promoter (BBa_R0010) and RBS (B0034) 2009-10-11T11:00:00Z 2015-05-08T01:11:24Z synthetic Released HQ 2013 lac + rbs false false _310_ 0 3473 9 In stock true none false Elisabeth Linton annotation2034625 1 BBa_B0034 range2034625 1 209 220 annotation2034626 1 BBa_R0010 range2034626 1 1 200 BBa_K844004_sequence 1 ggtggatatggtcctggagcaggtcaacaaggaccaggtagtcaaggacctggttctggaggtcaacaaggaccaggtggacaaggtggatatggtcctggagcaggtcaacaaggaccaggtagtcaaggacctggttctggaggtcaacaaggaccaggtggacaaggtccttatggaccaagtgcagcagcagcagcagca BBa_K844000_sequence 1 catcatcaccatcaccaccatcatcaccattaataa BBa_K208010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa BBa_K844008_sequence 1 atgggtggatatggtcctggagcaggtcaacaaggaccaggtagtcaaggacctggttctggaggtcaacaaggaccaggtggacaaggtggatatggtcctggagcaggtcaacaaggaccaggtagtcaaggacctggttctggaggtcaacaaggaccaggtggacaaggtccttatggaccaagtgcagcagcagcagcagca BBa_K844016_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgggtggatatggtcctggagcaggtcaacaaggaccaggtagtcaaggacctggttctggaggtcaacaaggaccaggtggacaaggtggatatggtcctggagcaggtcaacaaggaccaggtagtcaaggacctggttctggaggtcaacaaggaccaggtggacaaggtccttatggaccaagtgcagcagcagcagcagcatactagagggtggatatggtcctggagcaggtcaacaaggaccaggtagtcaaggacctggttctggaggtcaacaaggaccaggtggacaaggtggatatggtcctggagcaggtcaacaaggaccaggtagtcaaggacctggttctggaggtcaacaaggaccaggtggacaaggtccttatggaccaagtgcagcagcagcagcagcatactagagggtggatatggtcctggagcaggtcaacaaggaccaggtagtcaaggacctggttctggaggtcaacaaggaccaggtggacaaggtggatatggtcctggagcaggtcaacaaggaccaggtagtcaaggacctggttctggaggtcaacaaggaccaggtggacaaggtccttatggaccaagtgcagcagcagcagcagcatactagagggtggatatggtcctggagcaggtcaacaaggaccaggtagtcaaggacctggttctggaggtcaacaaggaccaggtggacaaggtggatatggtcctggagcaggtcaacaaggaccaggtagtcaaggacctggttctggaggtcaacaaggaccaggtggacaaggtccttatggaccaagtgcagcagcagcagcagcatactagagcatcatcaccatcaccaccatcatcaccattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z