BBa_K845002 1 GFP Strong RBS GFPmut2 2012-09-25T11:00:00Z 2015-05-08T01:13:33Z The protein comes from Aequorea victoria. This jellyfish uses GFP (Green Fluorescent Protein) in order to convert the blue luminescence emitted by the aequorine into a green luminescence RBS shine d'algarno GFP mut2 false false _1105_ 0 12465 9 Not in stock false http://www.weizmann.ac.il/mcb/UriAlon/Papers/Zaslaver_Ecoli_library.pdf false Gr??gory Hansen annotation2203925 1 GFPmut2 range2203925 1 26 743 annotation2203924 1 Strong RBS range2203924 1 1 26 BBa_K845000 1 pBAD-GFP iGEM 2012 Grenoble Team proposes a new design and application to the pBAD promoter(paraBAD). 2012-09-25T11:00:00Z 2015-05-08T01:13:33Z The part comes from the plasmid collection Alon (http://www.weizmann.ac.il/mcb/UriAlon/Papers/Zaslaver_Ecoli_library.pdf). However, pBAD is a natural promoter in E. Coli. It regulates the production of three proteins (AraA, AraB and AraD) which form the arabinose operon. Their production enables the use of arabinose as a carbon source. It has six regulation sites, five of them are devoted to AraC fixation (three are repressing, one has a dual activity and one is an activator); the last one is a CRP binding site (positive activity). This promoter is activated when both activated CRP and AraC are bind to it. GFP comes from the protein comes from Aequorea victoria. This jellyfish uses GFP (Green Fluorescent Protein) in order to convert the blue luminescence emitted by the aequorine into a green luminescence. Aequorea victoria: is a jellyfish that can be found off the coast of north America. In order to create a biological AND gate the 2012 Grenoble team worked on the cAMP-CRP complex and arabinose inductible promoter. The activity of the promoter was tested under several conditions (http://2012.igem.org/Team:Grenoble/Biology/Protocols/AND_test)using a GFP as a reporter (on a pUA66). We tested this activity in BW25113 ΔcyaA in different culture media (Glucose + Acetate; Glycerol; Acetate). false false _1105_ 0 12465 9 It's complicated false Design note: http://www.weizmann.ac.il/mcb/UriAlon/Papers/Zaslaver_Ecoli_library.pdf false Gr??gory Hansen component2203947 1 BBa_K845002 component2203944 1 BBa_K845001 annotation2203947 1 BBa_K845002 range2203947 1 500 1242 annotation2203944 1 BBa_K845001 range2203944 1 1 499 BBa_K845001 1 pBAD New paraBAD part 2012-09-25T11:00:00Z 2015-05-08T01:13:33Z pBAD is a natural promoter in E. Coli and is part of its genomic sequence. It regulates the production of three proteins (AraA, AraB and AraD) which form the arabinose operon. Their production enables the use of arabinose as a carbon source. It has six regulation sites, five of them are devoted to AraC fixation (three are repressing, one has a dual activity and one is an activator); the last one is a CRP binding site (positive activity). This promoter is activated when both activated CRP and AraC are bind to it. iGEM 2012 Grenoble Team proposes a new design and application to the pBAD promoter(paraBAD). In order to create a biological AND gate the 2012 Grenoble team worked on the cAMP-CRP complex and arabinose inductible promoter. false false _1105_ 0 12465 9 Not in stock false Our pBAD promoter has a longer sequence compared to the ones already registered and is composed of six regulation sites. 417 bp from the promoter to the ATG of araB plus the 82 first bp of the araB gene. false Gr??gory Hansen annotation2199721 1 AraC activator range2199721 1 367 383 annotation2199723 1 AraC dual activity (inhibitor/activator) range2199723 1 346 362 annotation2199737 1 AraC inhibitor range2199737 1 272 288 annotation2199738 1 AraC inhibitor range2199738 1 135 151 annotation2199720 1 paraBAD range2199720 1 1 499 annotation2199725 1 CRP activator range2199725 1 314 335 annotation2203948 1 AraB 82 first bp range2203948 1 418 499 annotation2199732 1 AraC inhibitor range2199732 1 293 309 BBa_K845002_sequence 1 tctagatttaagaaggagatatacatatgtctaaaggtgaagaattattcactggtgttgtcccaattttggttgaattagatggtgatgttaatggtcacaaattttctgtctccggtgaaggtgaaggtgatgctacttacggtaaattgaccttaaaatttatttgtactactggtaaattgccagttccatggccaaccttagtcactactttcgcgtatggtcttcaatgttttgctagatacccagatcatatgaaacaacatgactttttcaagtctgccatgccagaaggttatgttcaagaaagaactatttttttcaaagatgacggtaactacaagaccagagctgaagtcaagtttgaaggtgataccttagttaatagaatcgaattaaaaggtattgattttaaagaagatggtaacattttaggtcacaaattggaatacaactataactctcacaatgtttacatcatggctgacaaacaaaagaatggtatcaaagttaacttcaaaattagacacaacattgaagatggttctgttcaattagctgaccattatcaacaaaatactccaattggtgatggtccagtcttgttaccagacaaccattacttatccactcaatctgccttatccaaagatccaaacgaaaagagagaccacatggtcttgttagaatttgttactgctgctggtattacccatggtatggatgaattgtacaaataa BBa_K845001_sequence 1 caatcggcgttaaacccgccaccagatgggcgttaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccaccattcagagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaacccaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgtttttttggatggagtgaaacgatggcgattgcaattggcctcgattttggcagtgattctgtgcgagctttggcggtggactgcgctaccggtgaagctcgag BBa_K845000_sequence 1 caatcggcgttaaacccgccaccagatgggcgttaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccaccattcagagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaacccaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgtttttttggatggagtgaaacgatggcgattgcaattggcctcgattttggcagtgattctgtgcgagctttggcggtggactgcgctaccggtgaagctcgagtctagatttaagaaggagatatacatatgtctaaaggtgaagaattattcactggtgttgtcccaattttggttgaattagatggtgatgttaatggtcacaaattttctgtctccggtgaaggtgaaggtgatgctacttacggtaaattgaccttaaaatttatttgtactactggtaaattgccagttccatggccaaccttagtcactactttcgcgtatggtcttcaatgttttgctagatacccagatcatatgaaacaacatgactttttcaagtctgccatgccagaaggttatgttcaagaaagaactatttttttcaaagatgacggtaactacaagaccagagctgaagtcaagtttgaaggtgataccttagttaatagaatcgaattaaaaggtattgattttaaagaagatggtaacattttaggtcacaaattggaatacaactataactctcacaatgtttacatcatggctgacaaacaaaagaatggtatcaaagttaacttcaaaattagacacaacattgaagatggttctgttcaattagctgaccattatcaacaaaatactccaattggtgatggtccagtcttgttaccagacaaccattacttatccactcaatctgccttatccaaagatccaaacgaaaagagagaccacatggtcttgttagaatttgttactgctgctggtattacccatggtatggatgaattgtacaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z