BBa_K845001 1 pBAD New paraBAD part 2012-09-25T11:00:00Z 2015-05-08T01:13:33Z pBAD is a natural promoter in E. Coli and is part of its genomic sequence. It regulates the production of three proteins (AraA, AraB and AraD) which form the arabinose operon. Their production enables the use of arabinose as a carbon source. It has six regulation sites, five of them are devoted to AraC fixation (three are repressing, one has a dual activity and one is an activator); the last one is a CRP binding site (positive activity). This promoter is activated when both activated CRP and AraC are bind to it. iGEM 2012 Grenoble Team proposes a new design and application to the pBAD promoter(paraBAD). In order to create a biological AND gate the 2012 Grenoble team worked on the cAMP-CRP complex and arabinose inductible promoter. false false _1105_ 0 12465 9 Not in stock false Our pBAD promoter has a longer sequence compared to the ones already registered and is composed of six regulation sites. 417 bp from the promoter to the ATG of araB plus the 82 first bp of the araB gene. false Gr??gory Hansen annotation2199721 1 AraC activator range2199721 1 367 383 annotation2199738 1 AraC inhibitor range2199738 1 135 151 annotation2199737 1 AraC inhibitor range2199737 1 272 288 annotation2199723 1 AraC dual activity (inhibitor/activator) range2199723 1 346 362 annotation2199720 1 paraBAD range2199720 1 1 499 annotation2199725 1 CRP activator range2199725 1 314 335 annotation2203948 1 AraB 82 first bp range2203948 1 418 499 annotation2199732 1 AraC inhibitor range2199732 1 293 309 BBa_K845001_sequence 1 caatcggcgttaaacccgccaccagatgggcgttaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccaccattcagagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaacccaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgtttttttggatggagtgaaacgatggcgattgcaattggcctcgattttggcagtgattctgtgcgagctttggcggtggactgcgctaccggtgaagctcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z