BBa_K845003 1 rsmA rsmA gene from Pseudomonas Aeruginosa 2012-09-25T11:00:00Z 2015-05-08T01:13:33Z RsmA is a coding sequence from Pseudomonas aeruginosa which increases the pathogenicity by allowing type VI secretion. Taken alone, it does not code for a dangerous protein and it does not increase the risk level. The part... false false _1105_ 0 12465 9 In stock false ... false Gr??gory Hansen annotation2204302 1 rsmA range2204302 1 1 186 BBa_K845003_sequence 1 atgctgattctgactcgtcgggtcggagagaccctgatggtaggtgacgacgtcaccgtgacggtactgggtgtcaaagggaaccaggtgcgcatcggcgtcaacgcgccgaaggaagtcgccgtacaccgggaggaaatttaccagcgcatccagaaagagaaagatcaagagccaaaccattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z