BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K847100 1 BBa_K847100 Promotor-RBS 2012-09-28T11:00:00Z 2015-05-08T01:13:34Z http://partsregistry.org/Part:BBa_B0030 http://partsregistry.org/Part:BBa_J23100 Released HQ 2013 This part contains a constitutive promoter and strong RBS. The strength of this RBS is considered relative to BBa_B0031, BBa_B0032, BBa_B0033 and BBa_B0034. While the promotor is a member of a family of constitutive promotor parts labelled J23100 through J23119. false false _1107_ 0 12286 9 In stock false None false Bella A Okiddy, Julia Borden, Michelle Yu component2210119 1 BBa_J23100 component2210121 1 BBa_B0030 annotation2210121 1 BBa_B0030 range2210121 1 44 58 annotation2210119 1 BBa_J23100 range2210119 1 1 35 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0030_sequence 1 attaaagaggagaaa BBa_K847100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z