BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K847102 1 BBa_K847102 Engineered FliC with multiple cloning site 2012-10-01T11:00:00Z 2015-05-08T01:13:34Z TBA TBA false false _1107_ 0 11092 9 Not in stock false TBA false Julia Borden, Michelle Yu, Bella Okiddy annotation2209397 1 Conserved FliC N terminus range2209397 1 1 528 annotation2209398 1 Multiple Cloning Site range2209398 1 529 607 annotation2209399 1 Conserved FliC C terminus range2209399 1 608 903 BBa_K847101 1 BBa_K847101 Engineered FliC with insertable expression region 2012-10-01T11:00:00Z 2015-05-08T01:13:34Z TBA Released HQ 2013 TBA false false _1107_ 0 11092 9 In stock false TBA false Julia Borden, Michelle Yu, Bella Okiddy component2209426 1 BBa_B0030 component2209431 1 BBa_K847102 component2209438 1 BBa_B0015 component2209424 1 BBa_J23100 annotation2209438 1 BBa_B0015 range2209438 1 976 1104 annotation2209431 1 BBa_K847102 range2209431 1 65 967 annotation2209426 1 BBa_B0030 range2209426 1 44 58 annotation2209424 1 BBa_J23100 range2209424 1 1 35 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K847102_sequence 1 atggcacaagtcattaataccaacagcctctcgctgatcactcaaaataatatcaacaagaaccagtctgcgctgtcgagttctatcgagcgtctgtcctctggcttgcgtattaacagcgcgaaggatgacgcagcgggtcaggcgattgctaaccgtttcacctctaacattaaaggcctgactcaggcggcccgtaacgccaacgacggtatctccgttgcgcagaccaccgaaggcgcgctgtccgaaatcaacaacaacttacagcgtgtgcgtgaactgacggtacaggccactaccggtactaactctgagtctgatctgtcctctatccaggacgaaattaaatcccgtctggatgaaattgaccgcgtatctggtcagacccagttcaacggcgtgaacgtgctggcaaaaaatggctccatgaaaatccaggttggcgcaaatgataaccagactatcactatcgatctgaagcagattgatgctaaaactcttggccttgatggttttagcgttaaaggatccggcgggaccggcagatctggcaagcttggccatatgggccgatcgggcgcatgcggccccgggggggtcgacgctgttgcaaatggtaaaaccaccgatccgctgaaagcgctggacgatgctatcgcatctgtagacaaattccgttcttccctcggtgcggtgcaaaaccgtctggattccgcggttaccaacctgaacaacaccactaccaacctgtctgaagcgcagtcccgtattcaggacgccgactatgcgaccgaagtgtccaatatgtcgaaagcgcagatcatccagcaggccggtaactccgtgttggcaaaagctaaccaggtaccgcagcaggttctgtctctgctccagggttaa BBa_K847101_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagatggcacaagtcattaataccaacagcctctcgctgatcactcaaaataatatcaacaagaaccagtctgcgctgtcgagttctatcgagcgtctgtcctctggcttgcgtattaacagcgcgaaggatgacgcagcgggtcaggcgattgctaaccgtttcacctctaacattaaaggcctgactcaggcggcccgtaacgccaacgacggtatctccgttgcgcagaccaccgaaggcgcgctgtccgaaatcaacaacaacttacagcgtgtgcgtgaactgacggtacaggccactaccggtactaactctgagtctgatctgtcctctatccaggacgaaattaaatcccgtctggatgaaattgaccgcgtatctggtcagacccagttcaacggcgtgaacgtgctggcaaaaaatggctccatgaaaatccaggttggcgcaaatgataaccagactatcactatcgatctgaagcagattgatgctaaaactcttggccttgatggttttagcgttaaaggatccggcgggaccggcagatctggcaagcttggccatatgggccgatcgggcgcatgcggccccgggggggtcgacgctgttgcaaatggtaaaaccaccgatccgctgaaagcgctggacgatgctatcgcatctgtagacaaattccgttcttccctcggtgcggtgcaaaaccgtctggattccgcggttaccaacctgaacaacaccactaccaacctgtctgaagcgcagtcccgtattcaggacgccgactatgcgaccgaagtgtccaatatgtcgaaagcgcagatcatccagcaggccggtaactccgtgttggcaaaagctaaccaggtaccgcagcaggttctgtctctgctccagggttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0030_sequence 1 attaaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z