BBa_K851000 1 BBa_K851000 A3 Promoter phage &#981;(phi)29 2012-09-23T11:00:00Z 2015-05-08T01:13:34Z REFERENCES [1] http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=10756 [2] Camacho A & Salas M (2010) DNA bending and looping in the transcriptional control of bacteriophage &#981;29. FEMS Microbiol Rev. 34(5):828-841. [3] Sogo JM, Inciarte MR, Corral J, Vi??uela E & Salas M(1979) RNA polymerase binding sites and transcription map of the DNA of Bacillus subtilis phage &#981;29. J Mol Biol 127: 411???436. [4] Barthelemy I, Salas M & Mellado RP (1986) In vivo transcription of bacteriophage &#981;29 DNA: transcription initiation sites. J Virol 60: 874???879. [5] Mellado RP, Barthelemy I & Salas M (1986a) In vitro transcription of bacteriophage &#981;29 DNA. Correlation between in vitro and in vivo promoters. Nucleic Acids Res 14: 4731???4741. [6] Mellado RP, Barthelemy I & SalasM(1986b) In vivo transcription of bacteriophage &#981;29 DNA early and late promoter sequences. J Mol Biol 191: 191???197. [7] Barthelemy I & Salas M (1989) Characterization of a new prokaryotic transcriptional activator and its DNA recognition site. J Mol Biol 208: 225???232. [8] Nuez B, Rojo F & SalasM(1992) Phage &#981;29 regulatory protein p4 stabilizes the binding of the RNA polymerase to the late promoter in a process involving direct protein???protein contact. P Natl Acad Sci USA 89: 11401???11405. [9] Monsalve M, Menc??a M, Rojo F & Salas M (1995) Transcription regulation in Bacillus subtilis phage &#981;29: expression of the viral promoters throughout the infection cycle. Virology 207: 23???31. [10] Nuez B, Rojo F & SalasM(1992) Phage &#981;29 regulatory protein p4 stabilizes the binding of the RNA polymerase to the late promoter in a process involving direct protein???protein contact. P Natl Acad Sci USA 89: 11401???11405. [11] http://2012.igem.org/Team:UNAM_Genomics_Mexico [12] http://2012.igem.org/Team:UNAM_Genomics_Mexico/Project/Description [13] Dubey GP, Ben-Yehuda S. (2011) Intercellular nanotubes mediate bacterial communication. Cell.;144(4) :590-600 [14] Rojo F, Zaballos A & Salas M (1990) Bend induced by the phage &#981;29 transcriptional activator in the viral late promoter is required for activation. J Mol Biol 211: 713???725. [15] http://2012.igem.org/Team:UNAM_Genomics_Mexico/Notebook/ANDMetal A3 A3 is a promoter that comes from the Bacillus subtilis phage &#981;(phi)29 [1]. Bacteriophage &#981;29 protein p4 functions as transcriptional activator for A3 promoter. BIOLOGY A3 plays a major role in the transcriptional switch that divides bacteriophage &#981;29 infection in early and late phases [2, 3, 4, 5, 6]. A3 is the only late promoter of the &#981;29 viral particle and its transcript terminates at terminator TD1. In vitro, protein p4 activates transcription from the late promoter A3 by stabilizing &#963;^A-RNAP at the promoter [7, 8]. In vivo, the synthesis of p4 is required for the activation of late promoter A3 and for the repression of early promoters A2b and A2c [9,10]. For iGEM UNAM Genomics M??xico 2012 project [11], A3 was used in the design of an OR logic gate[12] using a recently described new type of communication system between Bacillus Subtilis cells called Nanotubes[13]. A3 was obtained from pFRC54 plasmid reported in [14] as described in [15]. false false _1111_ 0 12295 9 It's complicated true Primers used UPPER 5'-3'<br /> PREFIX+A3<br /> 5' GTTTCTTCGAATTCGCGGCCGCTTCTAGAG taactttttgcaaga 3'<br /> LOWER 5'-3'<br /> SUFIX+A3<br /> 5'GTTTCTTCCTGCAGCGGCCGCTACTAGTA ctacttaattatacc 3'<br /> false Abiel Trevi??o Garza annotation2196219 1 p4 recognition site 2 range2196219 1 33 64 annotation2196254 1 -10 range2196254 1 86 91 annotation2196218 1 p4 recognition site 1 range2196218 1 1 31 annotation2196253 1 Critical recognition nucleotide range2196253 1 29 29 annotation2196251 1 Critical Recognition nucleotide range2196251 1 3 3 BBa_K851000_sequence 1 aactttttgcaagacttttttataaaatgttgacgtttttcgacaagaacgcccacaaatccttatgtatcaagggttcacgtggtataattaagtagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z