BBa_K851002 1 BBa_K851002 pBAD-pXyl AND Gate 2012-09-23T11:00:00Z 2015-05-08T01:13:34Z REFERENCES [1] D Gartner, M Geissendorfer, & W Hillen(1988). Expression of the Bacillus subtilis xyl Operon Is Repressed at the Level of Transcription and Is Induced by Xylose J Bacteriol 170:7,3102-3109. [2] Shamanna, D. K., and K. E. Sanderson. 1979. Genetics and regulation of D-xylose utilization in Salmonella typhimurium LT2. J. Bacteriol. 139:71-79. [3] Wilhelm, M., and C. P. Hollenberg. 1985. Nucleotide sequence of the Bacillus subtilis xylose isomerase gene: extensive homology between the Bacillus and E. coli enzyme. Nucleic Acids Res. 13:5717-5722. [4] Lee, N. (1980) Molecular Aspects of ara Regulation. In The Operon, J. H. Miller and W. S. Reznikoff, eds. (Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory), pp. 389-410. [5] Lee, N., Francklyn, C., and Hamilton, E. P. (1987). Arabinose-Induced Binding of AraC Protein to araI2 Activates the araBAD Operon Promoter. Proc. Natl. Acad. Sci. USA 84, 8814-8818. [6] http://partsregistry.org/wiki/index.php/Part:BBa_I13458 [8] http://partsregistry.org/Part:BBa_K206000 [7] Schlief, R. (2000). Regulation of the L-arabinose operon of Escherichia coli. Trends in Genetics. 16(12):559-565. [9] http://2012.igem.org/Team:UNAM_Genomics_Mexico [10] http://2012.igem.org/Team:UNAM_Genomics_Mexico/Project/Description [11] Dubey GP, Ben-Yehuda S. (2011) Intercellular nanotubes mediate bacterial communication. Cell.;144(4):590-600 [12] Guzman, L.-M., Belin, D., Carson, M. J., and Beckwith, J. (1995). Tight Regulation, Modulation, and High-Level Expression by Vectors Containing the Arabinose PBAD Promoter. J. Bacteriol. 177, 4121-4130. [13] David, J. D., and H. Weismeyer. 1970. Control of xylose metabolism in Escherichia coli. Biochim. Biophys. Acta 201: 497-499. Released HQ 2013 pBAD-pXyl is a combined promoter of D-Xylose and L-arabinose sugar sensor systems which is designed to be activated only in the presence of both sugars in the medium therefore functioning as an AND logic gate. BIOLOGY pXyl is an inducible promoter regulated by the transcriptional regulator XylR which, in Bacillus subtilis, regulates the expression of xyl operon[1]. Gene expression under pXyl can be induced by the addition of D-Xylose to the medium [1, 2]. The nucleotide sequence was obtained from Wilhelm, M &C. P. Hollenberg, 1985[3]. In the presence of L-arabinose, expression from pBAD is turned on while the absence of L-arabinose produces very low levels of transcription from pBAD [4, 5]. More precisely, in the absence of arabinose, the repressor protein AraC (BBa_I13458[6]) binds to the AraI1 operator site of pBAD and the upstream operator site AraO2, blocking transcription[7], but in the presence of arabinose, AraC binds to it and changes its conformation such that it interacts with the AraI1 and AraI2 operator sites, permitting transcription[7]. The nucleotide sequence was similar of that in Part:BBa_K206000[8]. For iGEM UNAM Genomics M??xico 2012 project [9], pBAD/pXyl was used in the design of an AND logic gate[10] using a recently described new type of communication system between Bacillus Subtilis cells called Nanotubes[11]. false false _1111_ 0 12295 9 In stock true chimeric promotor false Abiel Trevi??o Garza annotation2196302 1 XylR Binding Site 2 range2196302 1 305 313 annotation2196277 1 pBad recognition region 1 range2196277 1 3 19 annotation2196301 1 XylR Binding Sites range2196301 1 288 299 annotation2196287 1 -35 range2196287 1 247 253 annotation2196278 1 Pbad recognition region 2 range2196278 1 161 174 annotation2196288 1 -10 range2196288 1 271 276 BBa_K851002_sequence 1 aagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcaagatagtccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataagttagtttgtttgggcaaacaaactaatgtgcaacttacttacaatatgacataaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z