BBa_K851003 1 BBa_K851003 XylR 2012-09-23T11:00:00Z 2015-05-08T01:13:34Z [1] http://partsregistry.org/Part:BBa_K143036 [2] http://partsregistry.org/Part:BBa_K174017 [3] http://www.ncbi.nlm.nih.gov/pubmed/2544559?dopt=Abstract [4] http://partsregistry.org/wiki/index.php/Part:BBa_K143014 [5] http://2012.igem.org/Team:UNAM_Genomics_Mexico [6] http://2012.igem.org/Team:UNAM_Genomics_Mexico/Project/Description [7] Dubey GP, Ben-Yehuda S. (2011) Intercellular nanotubes mediate bacterial communication. Cell.;144(4):590-600 [L3]http://partsregistry.org/Part:BBa_K143036#bibkey_1 XylR Since DNA of Part:BBa_K143036[1] from group: iGEM08_Imperial_College[2] wasn???t available in Registry distributions, we synthetized this DNA part, making it available. BIOLOGY Transcription is regulated by proteins which bind operator sequences around the transcription start site. These proteins can affect transcription positively (activators) or negatively (repressors). Many repressor proteins can be inactivated by addition of an inducer, such as xylose. XylR is the regulatory protein of the Xylose operon in B. subtilis[3] and is responsible for ensuring the xylose metabolism proteins are not expressed in the absence of xylose . Though XylR is endogenous to B. subtilis, XylR should be over-expressed to minimize the leakage of xylose inducible promoters. In the presence of xylose, the XylR multimer is unable to bind DNA and repression of transcription is released. It must be noted that in all B. subtilis strains with a functional endogenous xylose operon the xylose inducer will gradually be metabolized by the host. XylR can be used in conjunction with the Xylose operon promoter (BBa_K143014)[4], where the XylR will act as a receiver for an xylose input to result in an Polymerases per second (PoPS) output. For iGEM UNAM Genomics M??xico 2012 project [5], XylR together with pBAD/pXyl was used in the design of an AND logic gate[6] using a recently described new type of communication system between Bacillus Subtilis cells called Nanotubes[7]. false false _1111_ 0 12295 9 It's complicated false XylR from synthesis false Abiel Trevi??o Garza annotation2196328 1 XylR range2196328 1 1 1056 BBa_K851003_sequence 1 atgactggattaaataaatcaactgtctcatcacaggtaaacacgttaatgaaagaaagtatggtatttgaaataggtcaaggacaatcaagtggcggaagaagacctgtcatgcttgtttttaataaaaaggcaggatactccgttggaatagatgttggtgtggattatattaatggcattttaacagaccttgaaggaacaatcgttcttgatcaataccgccatttggaatccaattctccagaaataacgaaagacattttgattgatatgattcatcactttattacgcaaatgccccaatctccgtacgggtttattggtataggtatttgcgtgcctggactcattgataaagatcaaaaaattgttttcactccgaactccaactggagagatattgacttaaaatcttcgatacaagagaagtacaatgtgtctgtttttattgaaaatgaggcaaatgctggcgcatatggagaaaaactatttggagctgcaaaaaatcacgataacattatttacgtaagtatcagcacaggaatagggatcggtgttattatcaacaatcatttatatagaggagtaagcggcttctctggagaaatgggacatatgacaatagactttaatggtcctaaatgcagttgcggaaaccgaggatgctgggaattgtatgcttcagagaaggctttattaaaatctcttcagaccaaagagaaaaaactgtcctatcaagatatcataaacctcgcccatctgaatgatatcggaaccttaaatgcattacaaaattttggattctatttaggaataggccttaccaatattctaaatactttcaacccacaagccgtaattttaagaaatagcataattgaatcgcatcctatggttttaaattcaatgagaagtgaagtatcatcaagggtttattcccaattaggcaatagctatgaattattgccatcttccttaggacagaatgcaccggcattaggaatgtcctccattgtgattgatcattttctggacatgattacaatgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z