BBa_K851005 1 BBa_K851005 CzrA/ArsR new version (1) 2012-09-24T11:00:00Z 2015-05-08T01:13:34Z ==REFERENCES== [1] http://partsregistry.org/Part:BBa_K174015<br> [2] http://2009.igem.org/Team:Newcastle<br> [3]http://2009.igem.org/Team:Newcastle/Metalsensing <br> [4] http://partsregistry.org/Part:BBa_K174016<br> [5] http://partsregistry.org/Part:BBa_K174017<br> [6] http://2012.igem.org/Team:UNAM_Genomics_Mexico<br> [7] http://2012.igem.org/Team:UNAM_Genomics_Mexico/Project/Description <br> [8] Dubey GP, Ben-Yehuda S. (2011) Intercellular nanotubes mediate bacterial communication. Cell.;144(4) :590-600<br> [9] http://partsregistry.org/Part:BBa_K851006<br> [10] Sato, T., and Kobayashi, Y. (1998) The ars operon in the skin element of Bacillus subtilis confers resistance to arsenate and arsenite. J Bacteriol 180: 1655???1661. <br> [11] Moore CM, Gaballa A, Hui M, Ye RW, Helmann JD (2005). Genetic and physiological responses of Bacillus subtilis to metal ion stress. Mol Microbiol(1) , 27???40. <br> [12] Busenlehner LS, Pennella MA, Giedroc DP (2003). The SmtB/ArsR family of metalloregulatory transcriptional repressors: Structural insights into prokaryotic metal resistance. FEMS Microbiol Rev , 27:131-143. <br> [13] Charles M Moore and John D Helmann(2005). Metal ion homeostasis in Bacillus subtilis. Current Opinion in Microbiology, 8:188???195. <br> CzrA/ArsR(1) CzrA/ArsR(1) is a combination of two different metal sensor systems already present in Bacillus Subtilis. It was made with the combined ArsR binding site and CadA promoter. It is a variation of Biobrick Part:BBa_K174015[1] first proposed by Newcastle 2009 iGEM team [2] for the construction of a cadmium sensor[3] and also designed in with the combination of ArsR binding site (Part:BBa_K174016)[4] and cadA promoter (Part:BBa_K174017)[5]. The improvement made by our team is the modification of the ArsR binding site for a better repression of the promoter through steric impediment of the sigma factor binding to the -35 box. For iGEM UNAM Genomics M??xico 2012 project [6], CzrA/ArsR(1) was used in the design of an AND logic gate[7] using a recently described new type of communication system between Bacillus Subtilis cells called Nanotubes[8]. We synthetized three alternative forms of this part: which can be found here and in (PART CzrA/ArsR-Newcastle 2009)[1]and PART CzrA/ArsR-2(UNAM_Genomics 2012)[ 9]. BIOLOGY In B. subtilis, ArsR has been shown to de-repress arsenical stress response genes of the ars operon in response to As(III) and Sb(III) [10](Sato and Kobayashi, 1998). It also has been shown to respond to Cd(II) and Ag(I) stress[11]. ArsR/SmtB family metalloregulators negatively regulate genes involved with metal efflux [12]. Binding of inducers to one of (at least) two distinct metal binding sites triggers de-repression. ArsR negatively regulates itself, a gene of unknown function (yqcK) and genes encoding an As(III) efflux pump (arsB) and an As(V) reductase (arsC) [10,13]. CzrA (formerly YozA in Bacillus subtilis), an ArsR homolog, represses two metal efflux systems [11] which are induced in response to several metals (Zn(II), Cd(II), Co(II) and Ni(II) and weakly to Cu(II))[13]. Specifically, CzrA represses the CadA efflux ATPase and the cation diffusion facilitator CzcD. CzrA has the unusual ability to respond to both thiophilic metals and Zn(II), Co(II) and Ni(II). false false _1111_ 0 12295 9 It's complicated true steric impediment of the sigma factor binding to the -35 box false Abiel Trevi??o Garza annotation2196517 1 -10 range2196517 1 49 55 annotation2196518 1 CzrA range2196518 1 64 94 annotation2196516 1 -35 range2196516 1 24 30 annotation2196515 1 ArsR range2196515 1 10 25 BBa_K851005_sequence 1 gagtaatcaaaataaattgatttatttgacactttcttggaaaacaacatataataggtgtaacttatatatgagtatatgctcatatatataaaataaatacaatactcattgatacgctttgaagagggaaccctaaatcggaaggtaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z