BBa_K858004 1 BBa_K858004 NucB 2012-09-23T11:00:00Z 2015-05-08T01:13:34Z This part comes from the Bacillus subtilis strain 168. It is a 411 bp region from base 2652387 to 2652797. This protein is a nuclease that was taken from the Bacillus subtilis strain 168. The nuclease will degrade plasmid DNA found in biofilms and therefore hinder their growth. false false _1118_ 0 13541 9 Not in stock false This part was biobricked without need for site directed mutations. false Max Jacobs, Jake Sheppard, Sean Kalra BBa_K858004_sequence 1 atgaaaaaatggatggcaggcctgtttcttgctgcagcagttcttctttgtttaatggttccgcaacagatccaaggcgcatcttcgtatgacaaagtgttatattttccgctgtctcgttatccggaaaccggcagtcatattagggatgcgattgcagagggacatccagatatttgtaccattgacagagatggagcagacaaaaggcgggaggaatctttaaagggaatcccgaccaagccgggctatgaccgggatgagtggccgatggcggtctgcgaggaaggcggtgcaggggctgatgtccgatatgtgacgccttctgataatcgcggcgccggctcgtgggtagggaatcaaatgagcagctatcctgacggtaccagagtgctgtttattgtgcagtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z