BBa_K861050 1 BBa_K861050 FadR, fatty acid sensor from <i>E.coli str. K12</i> 2012-09-05T11:00:00Z 2015-05-08T01:13:35Z E.coli str.K12 lab mutant DH5&#945; FadR is a transcriptional regulator,which, when binding to acyl-CoA can either serve as activator for fatty acid synthetase gene like FabA, FabB and etc. or repressor for fatty acid degradation gene like FadA, FadB, FadD and etc. After long chain fatty acid is converted to fatty acyl- CoA by FadD, it can bind to FadR. This binding will alter the conformation of FadR and FadR can no longer bind to the DNA sequence it recognizes to fulfill its function. To our knowledge, there is no promoter exists in nature that can respond solely to FadR since those promoters are often regulated by glucose concentration or oxidative stress and many other factors. false true _1121_ 0 12357 9 In stock false None false Kuanwei Sheng BBa_K861050_sequence 1 atggtcattaaggcgcaaagcccggcgggtttcgcggaagagtacattattgaaagtatctggaataaccgcttccctcccgggactattttgcccgcagaacgtgaactttcagaattaattggcgtaacgcgtactacgttacgtgaagtgttacagcgtctggcacgagatggctggttgaccattcaacatggcaagccgacgaaggtgaataatttctgggaaacttccggtttaaatatccttgaaacactggcgcgactggatcacgaaagtgtgccgcagcttattgataatttgctgtcggtgcgtaccaatatttccactatttttattcgcaccgcgtttcgtcagcatcccgataaagcgcaggaagtgctggctaccgctaatgaagtggccgatcacgccgatgcctttgccgagctggattacaacatattccgcggcctggcgtttgcttccggcaacccgatttacggtctgattcttaacgggatgaaagggctgtatacgcgtattggtcgtcactatttcgccaatccggaagcgcgcagtctggcgctgggcttctaccacaaactgtcggcgttgtgcagtgaaggcgcgcacgatcaggtgtacgaaacagtgcgtcgctatgggcatgagagtggcgagatttggcaccggatgcagaaaaatctgccgggtgatttagccattcaggggcgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z