BBa_B0024 1 BBa_B0024 double terminator (B0012-B0011), reversed 2003-12-02T12:00:00Z 2015-08-31T04:07:20Z -- No description -- false false _1_ 0 24 7 In stock false true Caitlin Conboy BBa_K861052 1 BBa_K861052 Constitutive expressed FadR 2012-09-07T11:00:00Z 2015-05-08T01:13:35Z Escherichia coli str. K-12 substr. MG1655 - false false _1121_ 0 12357 9 It's complicated false None false Kuanwei Sheng component2182249 1 BBa_J23116 component2182251 1 BBa_B0030 component2182254 1 BBa_B0024 component2182253 1 BBa_K861050 annotation2182249 1 BBa_J23116 range2182249 1 1 35 annotation2182254 1 BBa_B0024 range2182254 1 793 887 annotation2182251 1 BBa_B0030 range2182251 1 44 58 annotation2182253 1 BBa_K861050 range2182253 1 65 784 BBa_K861050 1 BBa_K861050 FadR, fatty acid sensor from <i>E.coli str. K12</i> 2012-09-05T11:00:00Z 2015-05-08T01:13:35Z E.coli str.K12 lab mutant DH5&#945; FadR is a transcriptional regulator,which, when binding to acyl-CoA can either serve as activator for fatty acid synthetase gene like FabA, FabB and etc. or repressor for fatty acid degradation gene like FadA, FadB, FadD and etc. After long chain fatty acid is converted to fatty acyl- CoA by FadD, it can bind to FadR. This binding will alter the conformation of FadR and FadR can no longer bind to the DNA sequence it recognizes to fulfill its function. To our knowledge, there is no promoter exists in nature that can respond solely to FadR since those promoters are often regulated by glucose concentration or oxidative stress and many other factors. false true _1121_ 0 12357 9 In stock false None false Kuanwei Sheng BBa_J23116 1 BBa_J23116 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_J23116_sequence 1 ttgacagctagctcagtcctagggactatgctagc BBa_B0024_sequence 1 aaataataaaaaagccggattaataatctggctttttatattctctctctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtga BBa_K861052_sequence 1 ttgacagctagctcagtcctagggactatgctagctactagagattaaagaggagaaatactagatggtcattaaggcgcaaagcccggcgggtttcgcggaagagtacattattgaaagtatctggaataaccgcttccctcccgggactattttgcccgcagaacgtgaactttcagaattaattggcgtaacgcgtactacgttacgtgaagtgttacagcgtctggcacgagatggctggttgaccattcaacatggcaagccgacgaaggtgaataatttctgggaaacttccggtttaaatatccttgaaacactggcgcgactggatcacgaaagtgtgccgcagcttattgataatttgctgtcggtgcgtaccaatatttccactatttttattcgcaccgcgtttcgtcagcatcccgataaagcgcaggaagtgctggctaccgctaatgaagtggccgatcacgccgatgcctttgccgagctggattacaacatattccgcggcctggcgtttgcttccggcaacccgatttacggtctgattcttaacgggatgaaagggctgtatacgcgtattggtcgtcactatttcgccaatccggaagcgcgcagtctggcgctgggcttctaccacaaactgtcggcgttgtgcagtgaaggcgcgcacgatcaggtgtacgaaacagtgcgtcgctatgggcatgagagtggcgagatttggcaccggatgcagaaaaatctgccgggtgatttagccattcaggggcgataatactagagaaataataaaaaagccggattaataatctggctttttatattctctctctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtga BBa_B0030_sequence 1 attaaagaggagaaa BBa_K861050_sequence 1 atggtcattaaggcgcaaagcccggcgggtttcgcggaagagtacattattgaaagtatctggaataaccgcttccctcccgggactattttgcccgcagaacgtgaactttcagaattaattggcgtaacgcgtactacgttacgtgaagtgttacagcgtctggcacgagatggctggttgaccattcaacatggcaagccgacgaaggtgaataatttctgggaaacttccggtttaaatatccttgaaacactggcgcgactggatcacgaaagtgtgccgcagcttattgataatttgctgtcggtgcgtaccaatatttccactatttttattcgcaccgcgtttcgtcagcatcccgataaagcgcaggaagtgctggctaccgctaatgaagtggccgatcacgccgatgcctttgccgagctggattacaacatattccgcggcctggcgtttgcttccggcaacccgatttacggtctgattcttaacgggatgaaagggctgtatacgcgtattggtcgtcactatttcgccaatccggaagcgcgcagtctggcgctgggcttctaccacaaactgtcggcgttgtgcagtgaaggcgcgcacgatcaggtgtacgaaacagtgcgtcgctatgggcatgagagtggcgagatttggcaccggatgcagaaaaatctgccgggtgatttagccattcaggggcgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z