BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation7025 1 BBa_B0030 range7025 1 1 15 BBa_K861160 1 BBa_K861160 CRP, cAMP receptor protein 2012-09-06T11:00:00Z 2015-05-08T01:13:36Z Escherichia coli str. K-12 substr. MG1655 Coding region for cAMP receptor protein(CRP; also known as catabolite activator protein, CAP). cAMP receptor protein is a DNA-binding transcriptional dual regulator in bacteria. CRP protein binds cAMP.;which causes a conformational change that allows CRP to bind tightly to a specific DNA site in the promoters of the genes it controls. false false _1121_ 0 12357 9 In stock false None false Kuanwei Sheng BBa_K861161 1 BBa_K861161 CRP with a RBS and a terminator 2012-09-06T11:00:00Z 2015-05-08T01:13:36Z Escherichia coli str. K-12 substr. MG1655 Coding region for cAMP receptor protein(CRP; also known as catabolite activator protein, CAP). cAMP receptor protein is a DNA-binding transcriptional dual regulator in bacteria. CRP protein binds cAMP.;which causes a conformational change that allows CRP to bind tightly to a specific DNA site in the promoters of the genes it controls. This device contains CRP with a RBS and double terminators. false false _1121_ 0 12357 9 It's complicated false None false Kuanwei Sheng component2181969 1 BBa_B0030 component2181971 1 BBa_K861160 component2181972 1 BBa_B0024 annotation2181971 1 BBa_K861160 range2181971 1 22 654 annotation2181972 1 BBa_B0024 range2181972 1 663 757 annotation2181969 1 BBa_B0030 range2181969 1 1 15 BBa_B0024 1 BBa_B0024 double terminator (B0012-B0011), reversed 2003-12-02T12:00:00Z 2015-08-31T04:07:20Z -- No description -- false false _1_ 0 24 7 In stock false true Caitlin Conboy BBa_B0024_sequence 1 aaataataaaaaagccggattaataatctggctttttatattctctctctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtga BBa_K861160_sequence 1 atggtgcttggcaaaccgcaaacagacccgactctcgaatggttcttgtctcattgccacattcataagtacccatccaagagcacgcttattcaccagggtgaaaaagcggaaacgctgtactacatcgttaaaggctctgtggcagtgctgatcaaagacgaagagggtaaagaaatgatcctctcctatctgaatcagggtgattttattggcgaactgggcctgtttgaagagggccaggaacgtagcgcatgggtacgtgcgaaaaccgcctgtgaagtggctgaaatttcgtacaaaaaatttcgccaattgattcaggtaaacccggacattctgatgcgtttgtctgcacagatggcgcgtcgtctgcaagtcacttcagagaaagtgggcaacctggcgttcctcgacgtgacgggccgcattgcacagactctgctgaatctggcaaaacaaccagacgctatgactcacccggacggtatgcaaatcaaaattacccgtcaggaaattggtcagattgtcggctgttctcgtgaaaccgtgggacgcattctgaagatgctggaagatcagaacctgatctccgcacacggtaaaaccatcgtcgtttacggcactcgttaa BBa_K861161_sequence 1 attaaagaggagaaatactagatggtgcttggcaaaccgcaaacagacccgactctcgaatggttcttgtctcattgccacattcataagtacccatccaagagcacgcttattcaccagggtgaaaaagcggaaacgctgtactacatcgttaaaggctctgtggcagtgctgatcaaagacgaagagggtaaagaaatgatcctctcctatctgaatcagggtgattttattggcgaactgggcctgtttgaagagggccaggaacgtagcgcatgggtacgtgcgaaaaccgcctgtgaagtggctgaaatttcgtacaaaaaatttcgccaattgattcaggtaaacccggacattctgatgcgtttgtctgcacagatggcgcgtcgtctgcaagtcacttcagagaaagtgggcaacctggcgttcctcgacgtgacgggccgcattgcacagactctgctgaatctggcaaaacaaccagacgctatgactcacccggacggtatgcaaatcaaaattacccgtcaggaaattggtcagattgtcggctgttctcgtgaaaccgtgggacgcattctgaagatgctggaagatcagaacctgatctccgcacacggtaaaaccatcgtcgtttacggcactcgttaatactagagaaataataaaaaagccggattaataatctggctttttatattctctctctagtatataaacgcagaaaggcccacccgaaggtgagccagtgtga BBa_B0030_sequence 1 attaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z