BBa_K861170 1 BBa_K861170 PI ,Glucose-activated promoter 2012-09-06T11:00:00Z 2015-05-08T01:13:36Z Escherichia coli str. K-12 substr. MG1655 This is a promoter designed for the Eschaerichia coli . It includes the CRP-binding site and the RNA polymerase-binding site which have a overlap of several base pairs.So because of the steric hindrance between CRP and RNA polymerase,gene downstream of the promoter will be repressed at high concentration of CRP.In the cells ,low glucose concentration results in increased activity by adenylate cyclase. cAMP binds to the cAMP receptor protein, which, in its bound form, is able to bind tightly to the specific DNA site in the promoter and repress the gene downstream.On the contrary,high glucose concentration will result in the expression of the promoter. false false _1121_ 0 12357 9 Not in stock false Non false Kuanwei Sheng annotation2183481 1 Modified Consensus Crp binding site range2183481 1 15 36 BBa_K861170_sequence 1 ttgacagctagctcaaatgtgattataatcacattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z