BBa_K862003 1 precB precB 2012-06-07T11:00:00Z 2015-05-08T01:13:36Z E. coli MG1655 genome: http://ecoliwiki.net/colipedia/index.php/recB:Gene bp -70 to -1 before recB coding sequence. The recB promoter sequence was taken for the E. coli MG1655 genome sequence (http://ecoliwiki.net/colipedia/index.php/recB:Gene). We assumed the main promoter region to be located from -70 to -1 bp upstream the recB start codon. Therefore this sequence was synthesized and cloned on an oligo basis. We will not submit the physical DNA of this part, but we provide the oligo-sequences you can use for synthesizing and cloning this part in front of any EcoRI/XbaI precut reporter part. RecB_fw: aattcgcggccgcttctagagCCTGAAGGCTGGAAAGTGTGGGAGAACGTCAGCGCGTTGCAGCAAACAATGCCCCTGATGAGTGAAAAGAc RecB_rev: ctaggTCTTTTCACTCATCAGGGGCATTGTTTGCTGCAACGCGCTGACGTTCTCCCACACTTTCCAGCCTTCAGGctctagaagcggccgcg false false _1122_ 0 3317 9 Not in stock false the sequence was ordered on a synthetic oligo basis and cloned in front of EcoRI/XbaI reporter parts. false Charlotte Bunne, Mariam Harmouche, Stefan Holderbach, Anna Huhn and Jakob Kreft (in alphabetical order) BBa_K862003_sequence 1 cctgaaggctggaaagtgtgggagaacgtcagcgcgttgcagcaaacaatgcccctgatgagtgaaaaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z