BBa_K863111 1 CBDclos Cellulose binding domain of C. cellulovorans cellulose binding protein gene (Freiburg-Standard) 2012-09-17T11:00:00Z 2015-06-17T01:18:55Z Cloning-Vector Cellulose binding Domain of Clostridium cellulovorans cellulose binding protein gene (cbp A) http://www.ncbi.nlm.nih.gov/nuccore/M73817 false false _1123_ 4206 13080 9 In stock false The sequence starts with the Freiburg-prefix (ATG+NgoMIV-restriction-site) followed by 12 Bases (4 AS) of the cellulose binding protein gene in front of the CBD; then 12 bases (4 amino acids) of the cellulose binding protein gene behind the CBD; after that the sequence continues with a short GS-Linker and ends with the Freiburg-suffix (AgeI-restirction-site+TAA). false Moritz M??ller annotation2185122 1 TAA range2185122 1 316 318 annotation2185123 1 AgeI range2185123 1 310 315 annotation2185120 1 NgoMIV range2185120 1 4 9 annotation2185121 1 Cellulose Binding Protein range2185121 1 10 21 annotation2202131 1 Siltent mutation (A original) range2202131 1 93 93 annotation2185119 1 ATG range2185119 1 1 3 annotation2185126 1 Cellulose Binding Protein range2185126 1 298 303 annotation2185124 1 Cellulose binding domain (CBDclos) range2185124 1 22 297 annotation2185127 1 GS-Linker range2185127 1 304 309 BBa_K863111_sequence 1 atggccggctcatcaatgtcagttgaattttacaactctaacaaatcagcacaaacaaactcaattacaccaataatcaaaattactaacacgtctgacagtgatttaaatttaaatgacgtaaaagttagatattattacacaagtgatggtacacaaggacaaactttctggtgtgaccatgctggtgcattattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcgttaaagaaacagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaggcagcaccggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z