BBa_K863112 1 CBDclos(T7 Cellulose binding domain of C. cellulovorans with T7, RBS, GS-Linker (Freiburg-Standard) 2012-09-19T11:00:00Z 2015-06-17T01:20:18Z Cloning-vector Cellulose binding domain of the [http://www.ncbi.nlm.nih.gov/nucleotide/327179207?report=genbank&log$=nucltop&blast_rank=3&RID=152ZCN0E01N Cellulomonas fimi ATCC 484 exoglucanase gene] in Freiburg-standard false false _1123_ 4206 13080 9 Not in stock false Added the regulatory unit BBa_K525998 (T7+RBS) in front of the CBD and a short GS-Linker behind the domain and used Freiburg-Standard to be able to fuse proteins to the domain. false Moritz M??ller annotation2200498 1 silent mutation (A original) range2200498 1 112 112 annotation2188284 1 B0034 range2188284 1 21 32 annotation2188293 1 TAA range2188293 1 335 337 annotation2188283 1 BBa_K525998 range2188283 1 1 32 annotation2188292 1 AgeI range2188292 1 329 334 annotation2188288 1 Cellulose Binding Protein range2188288 1 35 40 annotation2188285 1 RBS range2188285 1 24 27 annotation2188290 1 Cellulose Binding Protein range2188290 1 317 322 annotation2188291 1 GS-Linker range2188291 1 323 328 annotation2188286 1 BBa_K863111 range2188286 1 35 337 annotation2188282 1 T7 promoter range2188282 1 1 20 annotation2188287 1 ATG range2188287 1 35 38 annotation2188289 1 Cellulose binding domain (CBDclos) range2188289 1 41 316 BBa_K863112_sequence 1 taatacgactcactatagggaaagaggagaaataatgtcagttgaattttacaactctaacaaatcagcacaaacaaactcaattacaccaataatcaaaattactaacacgtctgacagtgatttaaatttaaatgacgtaaaagttagatattattacacaagtgatggtacacaaggacaaactttctggtgtgaccatgctggtgcattattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcgttaaagaaacagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaggcagcaccggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z