BBa_K864100 1 SYFP2 Super Yellow Fluorescent Protein 2 (SYFP2) 2012-09-23T11:00:00Z 2016-01-21T02:29:24Z Amino acid sequence taken from the article by Kremers et al 2006. Released HQ 2013 This part codes for the bright yellow fluorescent protein SYFP2. SYFP2 is a GFP based monomeric protein with a narrow fluorescence emission spectrum with a maximum at 515 nm. Bacteria expressing SYFP2 are reported to be 12 times brighter than those expressing EYFP(Q69K) and almost 2-fold brighter than bacteria expressing Venus (Ref. 10.1021/bi0516273). Codon optimized for expression in E coli by DNA 2.0. Mutations compared to wtGFP amino acid sequence (GenBank Accession number M62653) are F46L F64L S65G S72A M153T V163A S175G T203Y A206K. false false _1124_ 4206 10137 9 In stock false The sequence has been codon optimized for expression in E coli by DNA 2.0. false Erik Gullberg annotation2196221 1 SYFP2 range2196221 1 1 717 BBa_K864100_sequence 1 atggttagcaagggcgaagaactttttacaggcgtagtaccgatcttagttgaattagacggcgacgttaacggtcataagtttagcgtgagcggtgagggtgaaggtgacgcaacttacggcaagctgaccctgaagctgatttgcacgacgggtaagctgccggtcccgtggcctaccctggtcacgaccttgggttatggcgttcagtgtttcgcgcgttatccggaccacatgaaacaacacgatttctttaagagcgcgatgccagaaggctatgtgcaggagcgtacgatctttttcaaagacgacggtaactacaagacgcgtgccgaagtcaaattcgaaggcgacaccctggtgaatcgcattgagctgaagggtattgatttcaaagaggatggcaatatcctgggtcacaagctggagtacaattacaattcccacaacgtttacatcaccgcagataaacagaaaaatggcatcaaagcgaatttcaaaatccgtcacaacattgaggacggtggtgttcaactggcggatcattaccagcaaaacaccccgattggtgacggtccggtcctgttgccggataaccattatctgtcttaccaaagcaaactgagcaaagatccgaacgagaagcgcgaccacatggtgctgctggagtttgtgaccgctgccggtattaccctgggtatggatgagctgtataaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z