BBa_K864102 1 BBa_K864102 B0034-SYFP2 2012-09-24T11:00:00Z 2015-05-08T01:13:37Z Assembly of K864100 and the B0034 from the registry. Released HQ 2013 This part is the Super Yellow Fluorescent Protein 2 (SYFP2) (<partinfo>BBa_K864100</partinfo>) with the strong <partinfo>BBa_B0034</partinfo> RBS. ===Usage and Biology=== This part is usable as a reporter. The very strong fluorescence means transcription can be detected at low levels. Colonies are very clearly seen on a UV table with most promoters. false false _1124_ 0 13993 9 In stock false Transcriptional leakage is present in some backbones, giving visibly fluorescent colonies even without promoter. false Arvid Hed??n Gynn?? component2197168 1 BBa_K864100 component2197166 1 BBa_B0034 annotation2197168 1 BBa_K864100 range2197168 1 19 741 annotation2197166 1 BBa_B0034 range2197166 1 1 12 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K864100 1 SYFP2 Super Yellow Fluorescent Protein 2 (SYFP2) 2012-09-23T11:00:00Z 2016-01-21T02:29:24Z Amino acid sequence taken from the article by Kremers et al 2006. Released HQ 2013 This part codes for the bright yellow fluorescent protein SYFP2. SYFP2 is a GFP based monomeric protein with a narrow fluorescence emission spectrum with a maximum at 515 nm. Bacteria expressing SYFP2 are reported to be 12 times brighter than those expressing EYFP(Q69K) and almost 2-fold brighter than bacteria expressing Venus (Ref. 10.1021/bi0516273). Codon optimized for expression in E coli by DNA 2.0. Mutations compared to wtGFP amino acid sequence (GenBank Accession number M62653) are F46L F64L S65G S72A M153T V163A S175G T203Y A206K. false false _1124_ 4206 10137 9 In stock false The sequence has been codon optimized for expression in E coli by DNA 2.0. false Erik Gullberg annotation2196221 1 SYFP2 range2196221 1 1 717 BBa_B0034_sequence 1 aaagaggagaaa BBa_K864100_sequence 1 atggttagcaagggcgaagaactttttacaggcgtagtaccgatcttagttgaattagacggcgacgttaacggtcataagtttagcgtgagcggtgagggtgaaggtgacgcaacttacggcaagctgaccctgaagctgatttgcacgacgggtaagctgccggtcccgtggcctaccctggtcacgaccttgggttatggcgttcagtgtttcgcgcgttatccggaccacatgaaacaacacgatttctttaagagcgcgatgccagaaggctatgtgcaggagcgtacgatctttttcaaagacgacggtaactacaagacgcgtgccgaagtcaaattcgaaggcgacaccctggtgaatcgcattgagctgaagggtattgatttcaaagaggatggcaatatcctgggtcacaagctggagtacaattacaattcccacaacgtttacatcaccgcagataaacagaaaaatggcatcaaagcgaatttcaaaatccgtcacaacattgaggacggtggtgttcaactggcggatcattaccagcaaaacaccccgattggtgacggtccggtcctgttgccggataaccattatctgtcttaccaaagcaaactgagcaaagatccgaacgagaagcgcgaccacatggtgctgctggagtttgtgaccgctgccggtattaccctgggtatggatgagctgtataaataataa BBa_K864102_sequence 1 aaagaggagaaatactagatggttagcaagggcgaagaactttttacaggcgtagtaccgatcttagttgaattagacggcgacgttaacggtcataagtttagcgtgagcggtgagggtgaaggtgacgcaacttacggcaagctgaccctgaagctgatttgcacgacgggtaagctgccggtcccgtggcctaccctggtcacgaccttgggttatggcgttcagtgtttcgcgcgttatccggaccacatgaaacaacacgatttctttaagagcgcgatgccagaaggctatgtgcaggagcgtacgatctttttcaaagacgacggtaactacaagacgcgtgccgaagtcaaattcgaaggcgacaccctggtgaatcgcattgagctgaagggtattgatttcaaagaggatggcaatatcctgggtcacaagctggagtacaattacaattcccacaacgtttacatcaccgcagataaacagaaaaatggcatcaaagcgaatttcaaaatccgtcacaacattgaggacggtggtgttcaactggcggatcattaccagcaaaacaccccgattggtgacggtccggtcctgttgccggataaccattatctgtcttaccaaagcaaactgagcaaagatccgaacgagaagcgcgaccacatggtgctgctggagtttgtgaccgctgccggtattaccctgggtatggatgagctgtataaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z