BBa_K864400 1 BBa_K864400 Ptac, trp & lac regulated promoter 2012-09-24T11:00:00Z 2015-05-08T01:13:37Z Created from oligos ordered from SigmaAldrich. Oligo sequences: Ptac+ AATTCGCGGCCGCTTCTAGAGGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTA Ptac- CTAGTAAATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGATGATTAATTGTCAACAGCTCCTCTAGAAGCGGCCGCG Released HQ 2013 The Ptac promoter is a functional hybrid promoter, derived from the trp and lac promoters, that are regulated by trp and lac [1]. This part also exist together with lacI, part [[Part:BBa_K180000|BBa_K180000]] [1] Proc. Natl. Acad. Sci. USA, Vol. 80, pp. 21-25 false false _1124_ 0 9827 9 In stock false Oligos ordered from SigmaAldrich were annealed to form a double stranded DNA segment, ready to be ligated into any BioBrick backbone. false Erik Lundin annotation2197236 1 Ptac range2197236 1 1 40 annotation2197240 1 lacO1 site range2197240 1 36 61 annotation2197238 1 -10 range2197238 1 29 33 annotation2197237 1 -35 range2197237 1 7 12 BBa_K864400_sequence 1 gagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z