BBa_K864440 1 BBa_K864440 Small RNA spot42 2012-09-24T11:00:00Z 2015-05-08T01:13:37Z It was biobricked from E-coli MG1655 Released HQ 2013 The natural smallRNA spot42 taken from the E-coli MG1655. SmallRNA is belived to interact in many metabolic pathways. The spot42 scaffold interacts with HFQ-proteins. It is in many cases shown to bind into the rbs area of the mRNA and thereby blocking translation initiation. ( V.Sharma, A.Yamamura Y.Yokobayashi, 2011 ) We wanted to use this sRNA for gene downregulation on translational level, in this case block the ribosome from binding to the rbs area. You can use this natural scaffold to make your own sRNA, inhibiting translation on a gene of your choice. The sRNA is coupled to a strong promotor, J23101 false false _1124_ 0 13994 9 In stock false It can be a bit tricky to do mutagenesis on it, like we did. We wanted to add a a random antisense area with primers. You cannot have any scars between the promotor and sRNA so we added our promotor with mutagenesis. false Hampus Elofsson, Sabri Jamal, Lisa Branzell annotation2198851 1 Spot42_Antisense range2198851 1 36 91 annotation2198848 1 J23101 range2198848 1 1 35 annotation2198854 1 Spot42_Scaffold range2198854 1 92 144 BBa_K864440_sequence 1 tttacagctagctcagtcctaggtattatgctagcgtagggtacagaggtaagatgttctatctttcagaccttttacttcacgtaatcggatttggctgaatattttagccgccccagtcagtaatgactggggcgtttttta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z