BBa_K864501 1 T22 T22, P22 late terminator 2012-09-24T11:00:00Z 2015-05-08T01:13:37Z Salmonella phage P22 Strong transcriptional terminator consisting of a 20 bp stem-loop from Salmonella phage P22. false false _1124_ 0 10137 9 Not in stock false Design based on McDowell et al 1994. false Erik Gullberg annotation2197326 1 stem_loop range2197326 1 5 34 BBa_K864501_sequence 1 aaataaagccctgagtttaaccgctcggggctttttgcgttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z