BBa_K864511 1 CP44 CP44 constitutive promoter 2012-09-23T11:00:00Z 2015-05-08T01:13:37Z P. Jensen, K Hammer Appl: "The Sequence of Spacers between the Consensus Sequences Modulates the Strength of Prokaryotic Promoters" Environ Microbiol. 64.1 (1998) 82???87. A constitutive E. coli promoter. Strength in E. coli is 34 Miller units according to beta-galactosidase assay in original study[1], meaning it is a quite strong promoter. [1]P. Jensen, K Hammer Appl: "The Sequence of Spacers between the Consensus Sequences Modulates the Strength of Prokaryotic Promoters" Environ Microbiol. 64.1 (1998) 82???87. false false _1124_ 0 13993 9 In stock false Promoter sequences in Lactococcus lactis were randomized while consensus segments were kept constant, giving a library of synthetic promoters. See original reference[1]. false Arvid Hed??n Gynn?? BBa_K864511_sequence 1 catcgggtagtttattcttgacaattaagtagagcctgatataatagttcagtactgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z