BBa_K866000 1 BBa_K866000 CFP Fusion brick 2012-09-24T11:00:00Z 2015-05-08T01:13:37Z This part was designed from [http://partsregistry.org/Part:BBa_E0020] with a deletion of "TG" in the start codon. This is a coding sequence for the Cyan Fluorescent Protein. It is based on the biobrick [http://partsregistry.org/Part:BBa_E0020], yet lags the bases "TG" from it's start codon, allowing direct fusion to other protein coding sequences for in-frame translation. false false _1126_ 0 12498 9 In stock true Two nucleotides (T and G) were removed from the CFP-start codon via site-directed mutagenesis using the following primer: {| border=1 align=center ! Primer name ! Primer ! Length ! G/C content ! Tm |- | MS 16 | 5'-GCGAATTCGCGGCCGCTTCTAGAGTGAGCAAGGGCGAGGAGCT-3' | 43 bp | 62.7 % | 90.3 ??C |- | MS 17 | 5'-GCCTGCAGCGGCCGCTACTAGTATTATTACTTGTACAGCTCGT-3' | 43 bp | 51.1 % | 80.5 ??C |} false Michael Boelker annotation2197051 1 CFP-Fusion range2197051 1 1 719 annotation2197050 1 Deletion of nucleotides T and G range2197050 1 1 1 BBa_K866000_sequence 1 gtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z