BBa_K872001 1 BBa_K872001 CO2 biosensor 2012-09-25T11:00:00Z 2015-05-08T01:13:37Z For module I secuence can be found in http://partsregistry.org/Part:BBa_K872000 For module II TU_Delft 2010 biobrick secuence can be found in http://partsregistry.org/Part:BBa_K398331 This compose part forms a system for CO2 biosensing based in two modules, the first module (module I) resembles a ???signal converter??? and the second module (module II) functions as a ???output generator???. The first module is compose by the mild promoter J23101 with rbs B0012 attached to protein sAC and terminator B0030. Protein sAC (for soluble Adenilate Cyclase) is a 854 bp long and its function is to generate cAMP form ATP based on HCO3- concentration. This protein is involved in pH sensing, CO2 sensing and even in spermatozoa capacitance. The second module is TU_Delft 2010 biobrick BBa_K398331 composed by cAMP-CRP inducible promoter pCaif with rbs B0032 attached to GFP and dual terminator B0010 and B0012 The system works as follow. CO2 diffuse into water and reaction with water (H2O) by carbonic anhydrase enzyme forming HCO3- and H+. HCO3- accumulates inside bacteria and activates sAC producing cAMP as and intermediate signaling molecule, cAMP activates CRP protein and binds in pCaif promoter activating the formation of GFP. This allowed us to measure the CO2 concentration (indirectly by the formation of bicarbonate ion) as a function of GFP. The next diagram illustrate the system. false false _1133_ 0 6616 9 Not in stock false BamHI restriction site added, this is a very sensitive biosensor false Ricardo Mungu??a D??az annotation2370361 1 BBa_K398331 range2370361 1 1467 2401 annotation2370329 1 stem_loop range2370329 1 1067 1110 annotation2370323 1 BBa_B0032 range2370323 1 172 184 annotation2370319 1 RBS-3\Weak range2370319 1 108 120 annotation2370356 1 stem_loop range2370356 1 2284 2327 annotation2370335 1 BBa_B0010 range2370335 1 1193 1272 annotation2370327 1 BBa_B0015 range2370327 1 1056 1184 annotation2370328 1 BBa_B0010 range2370328 1 1056 1135 annotation2370331 1 T7 TE range2370331 1 1151 1170 annotation2370359 1 polya range2370359 1 2388 2401 annotation2370351 1 RBS-3\Weak range2370351 1 1526 1538 annotation2370360 1 stop range2370360 1 2394 2394 annotation2370321 1 RBS range2370321 1 114 117 annotation2370325 1 RBS range2370325 1 178 181 annotation2370322 1 BBa_J23101 range2370322 1 129 163 annotation2370354 1 GFP protein range2370354 1 1545 2264 annotation2370357 1 BBa_B0012 range2370357 1 2361 2401 annotation2370342 1 BBa_B0015 range2370342 1 1330 1458 annotation2370345 1 T7 TE range2370345 1 1425 1444 annotation2370334 1 BBa_B0015 range2370334 1 1193 1321 annotation2370341 1 BBa_B0010 range2370341 1 1330 1409 annotation2370318 1 BBa_J23101 range2370318 1 65 99 annotation2370353 1 BBa_E0040 range2370353 1 1545 2264 annotation2370352 1 RBS range2370352 1 1532 1535 annotation2370358 1 T7 TE range2370358 1 2368 2387 annotation2370316 1 BBa_B0032 range2370316 1 44 56 annotation2370349 1 BBa_K398326 range2370349 1 1467 1517 annotation2370338 1 T7 TE range2370338 1 1288 1307 annotation2370346 1 polya range2370346 1 1445 1458 annotation2370337 1 BBa_B0012 range2370337 1 1281 1321 annotation2370330 1 BBa_B0012 range2370330 1 1144 1184 annotation2370347 1 stop range2370347 1 1451 1451 annotation2370333 1 stop range2370333 1 1177 1177 annotation2370317 1 RBS range2370317 1 50 53 annotation2370343 1 stem_loop range2370343 1 1341 1384 annotation2370332 1 polya range2370332 1 1171 1184 annotation2370324 1 RBS-3\Weak range2370324 1 172 184 annotation2370348 1 Crp-cAMP range2370348 1 1467 1487 annotation2370344 1 BBa_B0012 range2370344 1 1418 1458 annotation2370340 1 stop range2370340 1 1314 1314 annotation2370339 1 polya range2370339 1 1308 1321 annotation2370350 1 BBa_B0032 range2370350 1 1526 1538 annotation2370320 1 BBa_B0032 range2370320 1 108 120 annotation2370355 1 BBa_B0010 range2370355 1 2273 2352 annotation2370315 1 RBS-3\Weak range2370315 1 44 56 annotation2370326 1 BBa_K872000 range2370326 1 191 1047 annotation2370336 1 stem_loop range2370336 1 1204 1247 annotation2370314 1 BBa_J23101 range2370314 1 1 35 BBa_K872001_sequence 1 tttacagctagctcagtcctaggtattatgctagcaaagaggagaaaatgagcctatggaatgatttgcgattatttttcactcttgtcattatactcgtattcattttaattacaattcaaagccgtcgatcagaactgattgctcggtttgactttatttggaagcttcaggcattagacgaaggaaaagaaatggaaaaaagacatgcgcaaaatcgagctgttttagaaaatattttgccagcgcatgttgccgaatatttccttaaagaaactgaaagggctgaattgtactcagaagctcgagataatgctgcaatagtatttattacaattactgaatttgataaattttatatggaattggatgctaacaatgagggtgttgaatgtttacgacttcttaatgagattattgccgactttgatatgcaactcagtcgtgatgagtttaaatgcattgaaaagatcaaaacaatctcgactacatatatggcagcatcaggcttatttggtaaagtaaccggttattcacatgttgtcgccgttgtattatttgctattcgccttttagcccttatacaatatatcaatgaacattcgtttaataattttaatcttaggataggcattaatgttggtccggtggtagcaggtgttattggtgtcaagaagccacattatgatatttggggtaactcggtcaacgttgctagcagaatggatagttctggtgtagcgggcaaaatacaaataacggaagaaacgaaaaatatcttagaaaaagaaggcttcgagtttgaatgccgtggaataattaatgtaaaaggtaaaggtgatatgaagacatacttcattaaagtatcagaagaagacttgaattttgattttaataagatctgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataggatcctctagtaagcaggatttagctcacacttatcgacggtgaagttgcatactatcgatatactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z