BBa_K873000 1 BBa_K873000 heat shock 10kDa protein(hsp 10) groES coding resquence 2012-09-17T11:00:00Z 2015-05-08T01:13:38Z We gained it through PCR from the genome of Escherichia coli BL21(DE3), data were achieved from NCBI. Heat shock 10 kDa protein 1 (Hsp10) also known as chaperonin 10 (cpn10) or early-pregnancy factor (EPF) is a protein that in humans is encoded by the HSPE1 gene. The homolog in E. coli is GroES that is a chaperonin which usually works in conjunction with GroEL.[1] false false _1134_ 0 12429 9 It's complicated false groES is considered to cooprate with groEL to play the repair function, and we just try to use the only groES to make effects. false Yue Hu BBa_K873000_sequence 1 atgaacatccgtccgctgcatgaccgtgtgattgtgaaacgcaaagaagtggaaaccaagtcggcaggtggcattgtgctgaccggcagcgcggccgcaaaatctacccgtggtgaagtcctggcagtgggtaacggtcgcattctggaaaatggcgaagtgaaaccgctggatgtgaaggttggtgacattgttatctttaacgatggctatggtgtcaaaagtgaaaagatcgacaatgaagaagtcctgattatgagcgaaagtgacatcctggctatcgtggaagcgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z