BBa_K873002 1 BBa_K873002 HSP promoter 2012-09-17T11:00:00Z 2016-10-16T09:49:24Z We align the HSP promoters from the literature and then find the conserved sequence, then we just modified the promoter of groES of E.coli, and synthesis the part through BIC genescript. Released HQ 2013 This part is a heat shock promoter, it refers to the transcription factor sigma32. when the temperature rise, the transcription factor sigma32 expresses a lot and binds to the RNA ploymerase to recognize the conserved sequence in -35 and -10 region, then the promoter starts to transcript. false false _1134_ 29300 11547 9 In stock false The whole sequence of this part is only 90bp, so take a futher consideration if you intend to digest it for use. false yue hu BBa_K873002_sequence 1 tttttcccccttgaaggggcgaagcctcatccccatttctctggtca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z