BBa_K874041 1 BBa_K874041 125bp DNA spacer (inc. trailing NdeI site) 2012-09-21T11:00:00Z 2015-05-08T01:13:38Z None yet None yet false false _1135_ 0 12435 9 Not in stock false None yet false Ernst Bank annotation2192415 1 NdeI range2192415 1 126 131 annotation2192416 1 125bp Spacer range2192416 1 1 125 BBa_K874041_sequence 1 tccacctagttgtcaaggggttgtagagtgcggtctttcacacatgtcgccacctacaaggctttcagaaccagaacttgtagtgtgacttttttcggcggtggagtcgccgcagcaatggaccgcatatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z