BBa_K874300 1 BBa_K874300 IPTG inducible expression of M.ScaI methyltansferase (IPTG -> M.ScaI) (ScaI silently mutated out) 2012-09-22T11:00:00Z 2015-05-08T01:13:38Z None yet None yet false false _1135_ 0 12435 9 It's complicated false None yet false Ernst Bank component2194449 1 BBa_R0011 component2194474 1 BBa_S05078 annotation2194474 1 BBa_S05078 range2194474 1 64 1154 annotation2194449 1 BBa_R0011 range2194449 1 1 54 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2000 1 -35 range2000 1 20 25 annotation2002 1 -10 range2002 1 43 48 annotation2001 1 lac O1 range2001 1 26 42 annotation1999 1 lac O1 range1999 1 3 19 annotation7064 1 BBa_R0011 range7064 1 1 54 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939311 1 BBa_B0011 component939303 1 BBa_B0012 annotation939311 1 BBa_B0011 range939311 1 50 95 annotation939303 1 BBa_B0012 range939303 1 1 41 BBa_S05066 1 BBa_S05066 K874001:K874000 2012-09-18T11:00:00Z 2015-05-08T01:14:49Z false false _9_ 0 12435 9 Not in stock false false Ernst Bank component2187664 1 BBa_K874000 component2187655 1 BBa_B0032 annotation2187655 1 BBa_B0032 range2187655 1 1 13 annotation2187664 1 BBa_K874000 range2187664 1 74 988 BBa_K874000 1 BBa_K874000 M.ScaI Methyltransferase 2012-09-16T11:00:00Z 2015-05-08T01:13:38Z Natively found in Streptomyces caespitosus. Sequence obtained from REBASE. Synthesized by IDT. The M.ScaI protein is a type II methyltransferase (subtype beta) that recognises site on the DNA of the following sequence 5..AGTACT..3. It methylates this site at the 5th (Cytosine) nucleotide leaving ao an N4-methylcytosine (m4). This methylation type (m4) is not found in native E. coli nor is the recognition site methylated by any of E. coli's native methylation systems (Dam, Dcm). This part also includes a flexible linker with incorporated myc-tag at the N terminus of the protein. This will allow for easier creation of fusion proteins and expression verification using westerblot (using the myc antibodies). It can be assumed that M.ScaI (with linker) is expressed and folds properly in E. coli because its function has been verified by the iGEM Amsterdam 2012 team. false false _1135_ 0 12435 9 Not in stock true Contains no forbidden sites (according to the RFC-10 protocol). Contains no sites vulnerable to E. coli's native restriction systems. false Ernst Bank annotation2187005 1 stop range2187005 1 913 915 annotation2187003 1 start range2187003 1 1 3 annotation2187004 1 M.ScaI range2187004 1 1 912 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_S05078 1 BBa_S05078 K874090:B0014 2012-09-22T11:00:00Z 2015-05-08T01:14:49Z false false _9_ 0 12435 9 Not in stock false false Ernst Bank component2194441 1 BBa_K874090 component2194448 1 BBa_B0014 component2194440 1 BBa_S05066 annotation2194440 1 BBa_S05066 range2194440 1 1 988 annotation2194441 1 BBa_K874090 range2194441 1 989 996 annotation2194448 1 BBa_B0014 range2194448 1 997 1091 BBa_K874090 1 BBa_K874090 Modified BioBrick Scar (1st T -> C) 2012-09-21T11:00:00Z 2015-05-08T01:13:38Z None yet None yet false false _1135_ 0 12435 9 Not in stock false None yet false Ernst Bank BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K874300_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagtcacacaggaaagcgcatggccgccagctttcaagaacagaaactcatctctgaagaggatctggcacccggcatgtccgggcgggactttggatatgtgatacagtcgtccgctgcactatggaatcgactctctacattctcacagagaggaaaagccttggacaccaggcttgcagacatcaagaaggccctggggaagccgtactacgaaacctcggatgtccttctttaccacggcgacagtcttgagctgctcaagtcaatgcctcagcagattttcgaccttaccgtaactagcccaccttacaatattggcaaagagtacgagggtgtactgtcgatcgaggaatacatttcctggtgcgagacatggatgtcgcgcgttcatagggcgaccagcgcaggcggcgcattttggctcaatgttgggtacgtccctgtcccgaaccaaggaaaagcagtcccgattccttacctcttgtgggacaagagtccgttctacatgatccaggaagttgtctggaattacggggcgggagtggcgtctcgaaaatcgttttccccgcgcaatgaaaagtttctctggtatgtgcgcgacccgctgaattattacttcgacctcgattcggtgcgcgacccaaatgtgaaataccccaaccagaaaaagaatgggaagctcaaatgcaacccgttggggaaaaatcccactgacgtttggcagttccccaaggttacgtcgggcgcgaagagatcaagcgtggagcgcaccgcccatccggcacaattcccgtctgctgtcattgaacgggtcatcaaggcgtgcagcccttccgacggcgtcatcctggacccattcctcggttccggaacgacctcgctgaccgccagaaagcaaggccggtgcagcgtcggtatcgaaatccgcgaagactacctcgacatcgcggtgggacgcctggaggcggaggcgcaatccctcttctagcactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_S05078_sequence 1 tcacacaggaaagcgcatggccgccagctttcaagaacagaaactcatctctgaagaggatctggcacccggcatgtccgggcgggactttggatatgtgatacagtcgtccgctgcactatggaatcgactctctacattctcacagagaggaaaagccttggacaccaggcttgcagacatcaagaaggccctggggaagccgtactacgaaacctcggatgtccttctttaccacggcgacagtcttgagctgctcaagtcaatgcctcagcagattttcgaccttaccgtaactagcccaccttacaatattggcaaagagtacgagggtgtactgtcgatcgaggaatacatttcctggtgcgagacatggatgtcgcgcgttcatagggcgaccagcgcaggcggcgcattttggctcaatgttgggtacgtccctgtcccgaaccaaggaaaagcagtcccgattccttacctcttgtgggacaagagtccgttctacatgatccaggaagttgtctggaattacggggcgggagtggcgtctcgaaaatcgttttccccgcgcaatgaaaagtttctctggtatgtgcgcgacccgctgaattattacttcgacctcgattcggtgcgcgacccaaatgtgaaataccccaaccagaaaaagaatgggaagctcaaatgcaacccgttggggaaaaatcccactgacgtttggcagttccccaaggttacgtcgggcgcgaagagatcaagcgtggagcgcaccgcccatccggcacaattcccgtctgctgtcattgaacgggtcatcaaggcgtgcagcccttccgacggcgtcatcctggacccattcctcggttccggaacgacctcgctgaccgccagaaagcaaggccggtgcagcgtcggtatcgaaatccgcgaagactacctcgacatcgcggtgggacgcctggaggcggaggcgcaatccctcttctagcactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K874000_sequence 1 atgtccgggcgggactttggatatgtgatacagtcgtccgctgcactatggaatcgactctctacattctcacagagaggaaaagccttggacaccaggcttgcagacatcaagaaggccctggggaagccgtactacgaaacctcggatgtccttctttaccacggcgacagtcttgagctgctcaagtcaatgcctcagcagattttcgaccttaccgtaactagcccaccttacaatattggcaaagagtacgagggtgtactgtcgatcgaggaatacatttcctggtgcgagacatggatgtcgcgcgttcatagggcgaccagcgcaggcggcgcattttggctcaatgttgggtacgtccctgtcccgaaccaaggaaaagcagtcccgattccttacctcttgtgggacaagagtccgttctacatgatccaggaagttgtctggaattacggggcgggagtggcgtctcgaaaatcgttttccccgcgcaatgaaaagtttctctggtatgtgcgcgacccgctgaattattacttcgacctcgattcggtgcgcgacccaaatgtgaaataccccaaccagaaaaagaatgggaagctcaaatgcaacccgttggggaaaaatcccactgacgtttggcagttccccaaggttacgtcgggcgcgaagagatcaagcgtggagcgcaccgcccatccggcacaattcccgtctgctgtcattgaacgggtcatcaaggcgtgcagcccttccgacggcgtcatcctggacccattcctcggttccggaacgacctcgctgaccgccagaaagcaaggccggtgcagcgtcggtatcgaaatccgcgaagactacctcgacatcgcggtgggacgcctggaggcggaggcgcaatccctcttctag BBa_S05066_sequence 1 tcacacaggaaagcgcatggccgccagctttcaagaacagaaactcatctctgaagaggatctggcacccggcatgtccgggcgggactttggatatgtgatacagtcgtccgctgcactatggaatcgactctctacattctcacagagaggaaaagccttggacaccaggcttgcagacatcaagaaggccctggggaagccgtactacgaaacctcggatgtccttctttaccacggcgacagtcttgagctgctcaagtcaatgcctcagcagattttcgaccttaccgtaactagcccaccttacaatattggcaaagagtacgagggtgtactgtcgatcgaggaatacatttcctggtgcgagacatggatgtcgcgcgttcatagggcgaccagcgcaggcggcgcattttggctcaatgttgggtacgtccctgtcccgaaccaaggaaaagcagtcccgattccttacctcttgtgggacaagagtccgttctacatgatccaggaagttgtctggaattacggggcgggagtggcgtctcgaaaatcgttttccccgcgcaatgaaaagtttctctggtatgtgcgcgacccgctgaattattacttcgacctcgattcggtgcgcgacccaaatgtgaaataccccaaccagaaaaagaatgggaagctcaaatgcaacccgttggggaaaaatcccactgacgtttggcagttccccaaggttacgtcgggcgcgaagagatcaagcgtggagcgcaccgcccatccggcacaattcccgtctgctgtcattgaacgggtcatcaaggcgtgcagcccttccgacggcgtcatcctggacccattcctcggttccggaacgacctcgctgaccgccagaaagcaaggccggtgcagcgtcggtatcgaaatccgcgaagactacctcgacatcgcggtgggacgcctggaggcggaggcgcaatccctcttctag BBa_B0032_sequence 1 tcacacaggaaag BBa_K874090_sequence 1 cactagag BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z