BBa_C0061 1 luxI autoinducer synthetase for AHL 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 Synthesizes 3OC₆HSL, which binds to LuxR.</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound HSL. This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false false _1_ 0 24 7 In stock false <P> <P>An LVA tail (sequence: AANDENYALVA) was added to increase protein degradation. . <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation2213985 1 Help:Barcodes range2213985 1 619 643 annotation7038 1 BBa_C0061 range7038 1 1 618 annotation1761 1 luxI range1761 1 1 579 annotation1760 1 LVA range1760 1 580 611 BBa_K876014 1 BBa_K876014 pLac-LuxI 2012-09-29T11:00:00Z 2015-05-08T01:13:38Z Generated from biobricks Released HQ 2013 Constitutive promoter for LuxI which can be repressed by LacI false false _1138_ 0 13836 9 In stock false Biobrick placement false Timothy Cogan component2245106 1 BBa_R0010 component2245114 1 BBa_C0061 annotation2245114 1 BBa_C0061 range2245114 1 207 824 annotation2245106 1 BBa_R0010 range2245106 1 1 200 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961227 1 start range1961227 1 173 173 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_K876014_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_C0061_sequence 1 atgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaatgctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z