BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K117002 1 BBa_K117002 LsrA promoter (indirectly activated by AI-2) 2008-10-06T11:00:00Z 2015-05-08T01:09:34Z to be updated Released HQ 2013 The regulatory network for the uptake of Escherichia coli autoinducer 2 (AI-2) is comprised of a transporter complex, LsrABCD; its repressor, LsrR; and a cognate signal kinase, LsrK. This network is an integral part of the AI-2 quorum-sensing (QS) system. Once uptaken into the cell, AI-2 will be phosphorylated under the effect of LsrK. Without the presence of AI-2, LsrA promoter is inhibited by the repressor, LsrR. Phosphorylated AI-2 will prevent LsrR from inhibiting this promoter, hence activating it so that the downstream sequence can be expressed. To prevent the cell from self-inducing this promoter, we must suppress its AI-2 producing capability. It can be done by knocking out LuxS, one of the vital gene required for producing AI-2. By doing that, LsrA promoter can only be activated under the presence of AI-2 from other sources than the host cell which is LuxS mutant (say, by contact with normal cells). More information on AI-2 quorum-sensing (QS) system please refer to: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1952038 false false _209_ 0 2774 9 In stock true to be updated true Nguyen Xuan Hung annotation1979372 1 RBS BBa_B0034 range1979372 1 112 123 BBa_C0012 1 lacI lacI repressor from E. coli (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Coding region for the LacI protein with an LVA degradation tail and without an RBS. LacI binds to the pLac regulator <bb_part>BBa_R0010</bb_part> and PLlac01 hybrid regulator <bb_part>BBa_R0011</bb_part> and inhibits transcription. IPTG (Isopropylthiogalactoside) binds to LacI and inhibits its operation, therefore promoting transcription.</P> <P>A rapid degredation tail (LVA) has been added to improve the High to Low performance of this part.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M.B., Leibler, S. A synthetic oscillatory network of transcriptional regulators. <em>Nature</em> 403, 335-338 (2000). <a href="http://biobricks.ai.mit.edu/BB_References.htm#ELOW00">[ELOW00]</a><br> <br> </P> <P> References (unparsed) here: <p>Elowitz, M.B., Leibler, S. A synthetic oscillatory network of transcriptional regulators. <em>Nature</em> 403, 335-338 (2000). <a href="http://biobricks.ai.mit.edu/BB_References.htm#ELOW00">[ELOW00]</a><br> <br> </P> <P>Sequence taken from the repressilator of Elowitz and Leibler (2000). The obtained sequence was compared to the wild-type sequence for LacI obtained through a database search. The sequence had been modified from the wild-type in that wild-type GTG start was changed to an ATG start (note, actual ORF in E.coli has several GTG starts it would seem). The LVA tag has been added for quicker degradation.<P> Incompatible with systems containing LacI, lactose, or IPTG. true Grace Kenney, Daniel Shen, Neelaksh Varshney, Samantha Sutton annotation1723 1 lacI-LVA range1723 1 1 1128 annotation2213988 1 Help:Barcodes range2213988 1 1129 1153 annotation7031 1 BBa_C0012 range7031 1 1 1128 annotation1722 1 LVA range1722 1 1090 1128 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K876068 1 BBa_K876068 Term-Term-pLsrA-LacI 2012-10-01T11:00:00Z 2015-05-08T01:13:39Z N/A Released HQ 2013 TT-pLasrA-LacI false true _1138_ 0 13835 9 In stock false N/A false Zakaraya Ashour, Sanket Shah component2251336 1 BBa_B0015 component2251337 1 BBa_K117002 component2251339 1 BBa_C0012 annotation2251337 1 BBa_K117002 range2251337 1 138 239 annotation2251336 1 BBa_B0015 range2251336 1 1 129 annotation2251339 1 BBa_C0012 range2251339 1 246 1373 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K876068_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagcacaacatcaactgagtgcatgccttatttaatcatgtaactattcttacgacttcaaacgtcaaacagtcttaacacttatttaattaaaaagaggagaaatactagatggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_C0012_sequence 1 atggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K117002_sequence 1 cacaacatcaactgagtgcatgccttatttaatcatgtaactattcttacgacttcaaacgtcaaacagtcttaacacttatttaattaaaaagaggagaaa BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z