BBa_K877001 1 BBa_K877001 LPP-OmpA and CtCoh2 Combination 2012-09-30T11:00:00Z 2015-05-08T01:13:39Z The type 2 cohesin domain of this sequence comes from "Clostridium thermocellum" genome sequence. This part is a combination of the transmembrane anchoring protein, LPP-OmpA, from the 2008 Warsaw submission and the type 2 "Clostridium thermocellum" cohesin module. false false _1139_ 0 10647 9 In stock false The unstructuralized amino acid linker of LPP-OmpA in combination with a similar structure naturally occurring in the type 2 cohesin domain allowed the two domains to be combined without compromising functionality. The type cohesin amino acid linker was at the 5' end of the sequence while the LPP-OmpA amino acid linker was at the 3' end, because of this the sac1 restriction site added to the cohesin domain was added to the 5' end of its sequence. false David Pohlman, Alie Abele annotation2205283 1 linker range2205283 1 439 464 annotation2205280 1 NdeI range2205280 1 1 7 annotation2205281 1 OmpA range2205281 1 4 438 annotation2205284 1 SacI range2205284 1 459 464 annotation2205285 1 BBa_K103006 range2205285 1 1 464 annotation2205282 1 ATG range2205282 1 4 6 BBa_K877001_sequence 1 catatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagggaattaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagcgttgaaaacggtgcatacaaagctcagggcgttcaactgaccgctaaactgggttacccaatcactgacgacctggacatctacactcgtctgggtggcatggtatggcgtgcagacactaaatccaacgtttatggtaaaaaccacgacaccggcgtttctccggtcttcgctggcggtgttgagtacgcgatcactcctgaaatcgctacccgtctggaataccagtggaccaacaacatcggtgacgcacacaccatcggcactcgtccggacaacggcggaggttctggaggagggagctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z